Agkistrodon acutus is a traditional Chinese herb medicine which has immunological regulation,anti-tumor,anti-inflammatory and analgesic effects,which is mainly used for the treatment of rheumatoid arthritis,ankylosing spondylitis,sjogren's syndrome and tumors. In order to excavate more important functional genes from A. acutus,the transcriptome of the venom gland was sequenced by the Illumina Hi Seq 4000,and 32 862 unigenes were assembled. Among them,26 589 unigenes were mapped to least one public database. 2 695 unigenes were annotated and assigned to 62 TF families,and 5 920 SSR loci were identified. The majority of mapped unigenes was from Protobothrops mucrosquamatus in the NR database,which revealed their closest homology. Three secretory phospholipase A_2 with different amino acid sequences showed similar spatial structures and all had well-conserved active sites. The 3 D structural models of C-type lectin showed conserved glycosylation binding sites( Asn45). This study will lay the foundation for the further study of the function of snake venom protein,and promoting the development and utilization of genome resources from A. acutus.
Agkistrodon/genetics* ; Animals ; Crotalid Venoms ; Gene Expression Profiling ; Snake Venoms/genetics* ; Snakes ; Transcriptome

Thrombin-like enzymes (TLEs) are studied widely because of their therapeutic potential in myocardial infarction and thrombotic diseases. We synthesized the DNA fragment encoding thrombin-like enzyme calobin from Agkistrodon caliginosus (Korean Viper) venom by fusion PCR and expressed it in Pichia pastoris. After induction by 0.5% methanol for 48 h, the expression level of recombinant calobin reached 3.5 g/L in medium. The recombinant calobin was purified by Q-Sepharose Fast Flow ion-exchange chromatography and Sephacryl-S-100 gel filtration chromatography. Purified sample had a molecular weight of 32 kD shown in SDS-PAGE. It hydrolyzed fibrinogen and formed a light white hydrolysis circle in fibrinogen plate. SDS-PAGE analysis showed that recombinant calobin cleaved Aalpha-chain of fibrinogen specifically, and produced an appropriately 40 kD new band. However, we failed to find its fibrin-clot formation activity.
Agkistrodon ; Animals ; Pichia ; genetics ; metabolism ; Recombinant Proteins ; biosynthesis ; genetics ; Serine Endopeptidases ; biosynthesis ; genetics ; Thrombin ; biosynthesis ; genetics ; Viper Venoms ; enzymology

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Agkistrodon ; genetics ; Amino Acid Sequence ; Animals ; Base Sequence ; Cloning, Molecular ; Crotalid Venoms ; biosynthesis ; enzymology ; genetics ; DNA, Complementary ; chemistry ; genetics ; Escherichia coli ; genetics ; Metalloendopeptidases ; biosynthesis ; genetics ; Molecular Sequence Data ; Recombinant Proteins ; biosynthesis ; Reverse Transcriptase Polymerase Chain Reaction ; Sequence Analysis, DNA ; Sequence Homology, Nucleic Acid ; Thrombin ; biosynthesis ; genetics

OBJECTIVETo isolate and purify a new phospholipase A2 (PLA2) homologue from Agkistrodon blomhoffii siniticus and investigate its effects on the gene expression profile of Hep3B cells.

METHODSThe PLA2 homologue was isolated and purified by reverse-phase high-performance liquid chromatography (HPLC) and its purity was determined also by HPLC. The relative molecular mass of the homologue was measured by electrospray ionization mass spectrum. The gene expression profile of Hep3B cells was detected with gene chip after exposure of the cells to 139 microg/ml PLA2 homologue for 12 h.

RESULTSThe purity of the PLA2 homologue was 97.2%, whose relative molecular mass was 13,900. After exposure of Hep3B cells to 139 microg/ml PLA2 homologue for 12 h, 19 genes were down-regulated and 20 up-regulated in the cells. The genes showing altered expressions in response to the exposure were mainly involved in cell cycle control and DNA damage repair, cell apoptosis and senescence, production of signal transduction molecules and transcription factors, cell adhesion, angiogenesis, and tumor invasion and metastasis.

CONCLUSIONSThe PLA2 homologue induces alterations in the expression of a wide variety of genes involved in the growth and metastasis of tumor cells. The results of this study provide clues for further study of the possible mechanism for the action of PLA2 homologue on Hep3B cells.

Agkistrodon ; Animals ; Carcinoma, Hepatocellular ; genetics ; Chromatography, High Pressure Liquid ; DNA Damage ; drug effects ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic ; drug effects ; Hyaluronan Receptors ; biosynthesis ; genetics ; Isoenzymes ; Liver Neoplasms ; genetics ; Phospholipases A ; isolation & purification ; pharmacology ; Phospholipases A2 ; Proto-Oncogene Proteins c-bcr ; biosynthesis ; genetics ; Snake Venoms ; enzymology ; Tumor Cells, Cultured