AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: Based on spinopelvic parameters and biomechanical principles, the pedicle-facet joint (PFJ) morphological characteristics of isthmic and degenerative spondylolisthesis were analyzed, and the mechanism of their onset and progression was discussed. Methods: This retrospective cross-sectional study included 194 patients with L5 spondylolysis or L5–S1 low-grade isthmic spondylolisthesis (IS group), 172 patients with L4–5 degenerative spondylolisthesis (DS group), and 366 patients with nonlumbar spondylolysis (NL group). The spinopelvic parameters and PFJ morphological parameters of the patients were measured, the differences in these parameters among and within the 3 groups were compared, and the correlations were analyzed. Results: Sacral slope (SS) and lumbar lordosis (LL) were the highest in the IS group, the second highest in the DS group, and the lowest in the NL group. Among the 3 groups, the L4 facet joint angle (FJA) was the largest in the IS group, the second largest in the NL group, and the smallest in the DS group. The L4 pedicle-facet joint angle (PFA) was the largest in the DS group, the second largest in the IS group, and the smallest in the NL group. Pearson correlation analysis showed that within each group, SS and LL were negatively correlated with FJA and positively correlated with PFA. Conclusion This study found a correlation between the PFJ morphological characteristics of patients with lumbar spondylolisthesis and spinopelvic parameters, suggesting that the morphological characteristics of PFJs may be caused by varying stresses under different spinopelvic morphologies.

Purpose: Erectile dysfunction (ED) is a common male sexual dysfunction. Gut microbiota plays an important role in various diseases. To investigate the effects and mechanisms of intestinal flora dysregulation induced by high-fat diet (HFD) on erectile function. Materials and Methods: Male Sprague–Dawley rats aged 8 weeks were randomly divided into the normal diet (ND) and HFD groups. After 24 weeks, a measurement of erectile function was performed. We performed 16S rRNA sequencing of stool samples. Then, we established fecal microbiota transplantation (FMT) rat models by transplanting fecal microbiota from rats of ND group and HFD group to two new groups of rats respectively. After 24 weeks, erectile function of the rats was evaluated and 16S rRNA sequencing was performed, and serum samples were collected for the untargeted metabolomics detection. Results: The erectile function of rats and the species diversity of intestinal microbiota in the HFD group was significantly lower, and the characteristics of the intestinal microbiota community structure were also significantly different between the two groups. The erectile function of rats in the HFD-FMT group was significantly lower than that of rats in the ND-FMT group. The characteristics of the intestinal microbiota community structure were significantly different. In the HFD-FMT group, 27 metabolites were significantly different and they were mainly involved in the several inflammation-related pathways. Conclusions Intestinal microbiota disorders induced by HFD can damage the intestinal barrier of rats, change the serum metabolic profile, induce low-grade inflammation and apoptosis in the corpus cavernosum of the penis, and lead to ED.

Purpose: The aim of this study was to investigate the feasibility of an intelligent handheld ultrasound (US) device for assisting non-expert general practitioners (GPs) in detecting carotid plaques (CPs) in community populations. Methods: This prospective parallel controlled trial recruited 111 consecutive community residents. All of them underwent examinations by non-expert GPs and specialist doctors using handheld US devices (setting A, setting B, and setting C). The results of setting C with specialist doctors were considered the gold standard. Carotid intima-media thickness (CIMT) and the features of CPs were measured and recorded. The diagnostic performance of GPs in distinguishing CPs was evaluated using a receiver operating characteristic curve. Inter-observer agreement was compared using the intragroup correlation coefficient (ICC). Questionnaires were completed to evaluate clinical benefits. Results: Among the 111 community residents, 80, 96, and 112 CPs were detected in settings A, B, and C, respectively. Setting B exhibited better diagnostic performance than setting A for detecting CPs (area under the curve, 0.856 vs. 0.749; P<0.01). Setting B had better consistency with setting C than setting A in CIMT measurement and the assessment of CPs (ICC, 0.731 to 0.923). Moreover, measurements in setting B required less time than the other two settings (44.59 seconds vs. 108.87 seconds vs. 126.13 seconds, both P<0.01). Conclusion Using an intelligent handheld US device, GPs can perform CP screening and achieve a diagnostic capability comparable to that of specialist doctors.

ObjectiveBased on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS/MS）， network pharmacology and molecular docking techniques， to explore the pharmacodynamic material basis and mechanism of Renshen Wuweizi Tang in treating spleen-lung Qi deficiency syndrome. MethodsThe chemical components in the decoction of Renshen Wuweizi Tang were systematically characterized and identified by UPLC-Q-TOF-MS/MS， and network pharmacology was used to screen potential active ingredients， collect component targets and gene sets related to spleen-lung Qi deficiency syndrome， and obtain protein interaction relationships through STRING. Cytoscape 3.9.1 was used to construct a "formula-syndrome" association network and calculate topological feature values. Gene ontology（GO） function and Kyoto Encyclopedia of Genes and Genomes（KEGG） pathway enrichment analysis were performed on core genes to explore potential pharmacodynamic links， the average shortest path between the formula-drug target network and the pharmacodynamic link gene network was calculated to discover dominant pharmacodynamic links， and MCODE plugin was used to identify core gene clusters from the dominant pharmacodynamic links， which were validated using Gene Expression Omnibus（GEO）， and molecular docking was performed between key components and core targets. ResultsOne hundred and thirty-seven components were identified in the negative ion mode， and eighty components were identified in the positive ion mode. After deduplication， a total of 185 components were identified， mainly composed of triterpenoid saponins（49） and flavonoids（54）. Based on the "formula-syndrome" correlation network analysis， energy metabolism was determined to be the dominant pharmacodynamic link of Renshen Wuweizi Tang in the treatment of spleen-lung Qi deficiency syndrome. The results of molecular docking showed that 7 components（adenosine， atractylenolide Ⅱ， atractylenolide Ⅲ， ginsenoside Rg₁， glycyrrhizin B₂， glycyrrhizin E₂ and campesterol） from 4 medicinal materials（Ginseng Radix et Rhizoma， Atractylodis Macrocephalae Rhizoma， Glycyrrhizae Radix et Rhizoma and Poria） in this formula might regulate energy metabolism by acting on 6 targets， namely cyclic adenosine monophosphate-response element binding protein 1（CREB1）， glyceraldehyde-3-phosphate dehydrogenase（GAPDH）， interleukin（IL）-6， nuclear transcription factor（NF）-κB1， peroxisome proliferator-activated receptor α（PPARα）， and tumor necrosis factor（TNF）， thus improving the symptoms of diseases related to spleen-lung Qi deficiency syndrome. ConclusionThis study established a UPLC-Q-TOF-MS/MS for rapid characterization and identification of chemical components in the decoction of Renshen Wuweizi Tang， expanding the understanding of the material composition of this formula， and found that 7 components might act on the key advantageous pharmacodynamic link "energy metabolism" through 6 targets to improve the related symptoms of spleen-lung Qi deficiency syndrome. This can provide a reference for the subsequent exploration of the material benchmark and mechanism of the famous classical formula.

Objective To systematically evaluate the risk prediction model of anastomotic fistula after radical resection of esophageal cancer, and to provide objective basis for selecting a suitable model. Methods A comprehensive search was conducted on Chinese and English databases including CNKI, Wanfang, VIP, CBM, PubMed, EMbase, Web of Science, The Cochrane Library for relevant studies on the risk prediction model of anastomotic fistula after radical resection of esophageal cancer from inception to April 30, 2023. Two researchers independently screened literatures and extracted data information. PROBAST tool was used to assess the risk of bias and applicability of included literatures. Meta-analysis was performed on the predictive value of common predictors in the model with RevMan 5.3 software. Results A total of 18 studies were included, including 11 Chinese literatures and 7 English literatures. The area under the curve (AUC) of the prediction models ranged from 0.68 to 0.954, and the AUC of 10 models was >0.8, indicating that the prediction performance was good, but the risk of bias in the included studies was high, mainly in the field of research design and data analysis. The results of the meta-analysis on common predictors showed that age, history of hypertension, history of diabetes, C-reactive protein, history of preoperative chemotherapy, hypoproteinemia, peripheral vascular disease, pulmonary infection, and calcification of gastric omental vascular branches are effective predictors for the occurrence of anastomotic leakage after radical surgery for esophageal cancer (P<0.05). Conclusion The study on the risk prediction model of anastomotic fistula after radical resection of esophageal cancer is still in the development stage. Future studies can refer to the common predictors summarized by this study, and select appropriate methods to develop and verify the anastomotic fistula prediction model in combination with clinical practice, so as to provide targeted preventive measures for patients with high-risk anastomotic fistula as soon as possible.

The analysis presented here is based on the blood components of Guanxin Qiwei tablets, the key anti-atherosclerosis pathway of Guanxin Qiwei tablets was screened by network pharmacology, and the anti-atherosclerosis mechanism of Guanxin Qiwei tablets was clarified and verified by cell experiments. HPLC-Q-Exactive-MS/MS technique was used to analyze the components of Guanxin Qiwei tablets into blood, to determine the precise mass charge ratio of the compounds, and to conduct a comprehensive analysis of the components by using secondary mass spectrometry fragments and literature comparison. Finally, a total of 42 components of Guanxin Qiwei tablets into blood were identified. To better understand the interactions, we employed the Swiss Target Prediction database to predict the associated targets. Atherosclerosis (AS) disease targets were searched in disease databases Genecard, OMIM and Disgent, and 181 intersection targets of disease targets and component targets were obtained by Venny 2.1.0 software. Protein interactions were analyzed by String database. The 32 core targets were selected by Cytscape software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed in DAVID database. It was found that the anti-atherosclerosis pathways of Guanxin Qiwei tablets mainly include lipid metabolism and atherosclerosis and AGE-RAGE signaling pathway in diabetic complications and other signal pathways. The core targets and the core compounds were interlinked, and it was found that cryptotanshinone and tanshinone ⅡA in Guanxin Qiwei tablets were well bound to TNF, PPARγ, AKT1, PTG2 and other targets. The lipid metabolism and atherosclerotic pathway was verified using human hl-7702 hepatocytes. This study preliminarily identified the potential pharmacodynamic components of Guanxin Qiwei tablets in the treatment of AS diseases and predicted their pathways of action, and verified the relationship between regulating lipid metabolism and atherosclerosis of Guanxin Qiwei tablets in vitro, providing a reference for the further study of the pharmacodynamic material basis and mechanism of action of this prescription. This experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202401262).

OBJECTIVE To explore optimization pathways for the drug traceability code management model in outpatient pharmacy workflows， providing practical evidence for enhancing the efficiency of pharmaceutical service. METHODS Taking the outpatient pharmacy of the First Affiliated Hospital of Sun Yat-sen University as the research subject， a comprehensive drug traceability system was established through three key interventions： upgrading the information system architecture [including integration of the hospital information system （HIS） with the traceability platform]， workflow optimization （reorganizing the inventory-dispensing-verification tripartite process）， and designing a dual-mode traceability data collection mechanism （primary data capture at dispensing stations and supplementary capture at verification stations）. Operational efficiency differences before and after implementation were analyzed using the medical insurance data and service timeliness metrics in September 2024. RESULTS After the implementation of drug traceability code management， in terms of data collection: Mode Ⅰ （verification-stage capture） uploaded 26 144 records， while Mode Ⅲ （inventory-as-sales capture） uploaded 443 061 records， totaling 469 205 entries； in terms of time efficiency： average drug dispensing time increased from 28.74 s to 43.37 s （enhanced by 51%）. Through dynamic staffing adjustments， patient wait time only extended from 8.04 min to 8.67 min （enhanced by 8%）. CONCLUSIONS Drug traceability code management can be effectively implemented via a “system reconstruction-process reengineering-human-machine collaboration” trinity strategy， leveraging informatization （e.g.， dual-mode data capture） to offset manual operation delays， which validates the feasibility of balancing national traceability demands with service efficiency in outpatient pharmacies.

Sleep， skin， and health are closely interconnected. Clinically， insomnia has a high incidence and is often accompanied by or secondary to skin aging. The two conditions exhibit "different diseases with the same syndrome"， significantly affecting the physical and mental health of the Chinese population. Preventing and treating skin aging by improving insomnia is an important strategy， with the principle of "treating different diseases with the same approach" serving as a crucial therapeutic guideline. However， effective clinical prevention and treatment methods for both conditions remain lacking. Traditional Chinese medicine （TCM） has a profound theoretical foundation and notable efficacy in the concurrent treatment of insomnia and skin aging， yet there are few reports on the etiology， pathogenesis， therapeutic principles， and treatment methods of their shared treatment， warranting further exploration. Based on holistic view and syndrome differentiation and treatment in TCM， this study systematically investigates the theoretical origins of the shared manifestations of insomnia and skin aging from multiple dimensions， including etiology， pathological location， pathogenesis， disease nature， and prevention and treatment strategies. As early as Huangdi's Internal Classic （Huangdi Neijing）， it was recognized that mental clarity during the day， sound sleep at night， and firm， healthy skin are key indicators of external health， whereas daytime lethargy， poor sleep quality， and dry， withered skin are prominent signs of aging. Maintaining mental clarity during the day and restful sleep at night is essential for skin integrity and healthy aging. Later medical scholars proposed that the common etiology of insomnia and skin aging lies in "internal-external interactions"， with the pathological location involving "the five organ systems". The primary pathogenesis includes "deficiency， fire， stagnation， phlegm， and blood stasis"， while the disease nature is often characterized by "a combination of deficiency and excess". Treatment should be guided by syndrome differentiation， following the principle of balancing Yin and Yang. This theoretical exploration enriches and advances TCM understanding of disease onset and prevention， providing theoretical guidance for the clinical prevention and treatment of insomnia-associated skin aging and contributing to the realization of the "Healthy China" initiative.