1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
3.Advances in neoadjuvant therapy for locally advanced resectable esophageal cancer
Xiaozheng KANG ; Ruixiang ZHANG ; Zhen WANG ; Xiankai CHEN ; Yong LI ; Jianjun QIN ; Yin LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):153-159
Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.
4.Anti-osteoporosis Effect of Isorhamnetin: A Review
Shilong MENG ; Xu ZHANG ; Yawei XU ; Yang YU ; Wei LI ; Yanguang CAO ; Xiaolin SHI ; Wei ZHANG ; Kang LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(5):347-352
Osteoporosis is a common senile bone metabolism disease, clinically characterized by decreased bone mass, destruction of bone microstructure, increased bone fragility, and easy fracture. It tends to occur in the elderly and postmenopausal women, seriously threatening the quality of life and physical and mental health of the elderly. At present, the treatment of osteoporosis is mainly based on oral western medicines, such as calcium, Vitamin D, and bisphosphonates. Still, there are drawbacks such as a long medication cycle and many adverse reactions. In recent years, due to the advantages of multi-component, multi-pathway, and multi-target, some traditional Chinese medicines and effective ingredients can regulate the osteogenic and osteoclastic differentiation process in both directions and are widely used in the prevention and treatment of osteoporosis. Hippophae rhamnoides is a commonly used herbal medicine, and its fruits are rich in flavonoids, polyphenols, fatty acids, vitamins, and trace elements, which have been proven to have a good anti-osteoporosis effect. Isorhamnetin is the main effective ingredient of Hippophae rhamnoides fruits, which has many pharmacological effects such as anti-inflammation, anti-oxidative stress, anti-aging, and anti-tumor. Studies have shown that isorhamnetin can participate in the regulation of bone metabolism and has a good anti-osteoporosis effect. However, the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis have not been systematically summarized. Therefore, this paper reviewed the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis by referring to relevant literature to provide more basis for the development and application of isorhamnetin.
5.Mechanism of Different Dosage Forms of Kaixinsan in Improving Mitochondrial Function for Prevention and Treatment of Cognitive Disorder Based on AMPK/PGC-1α/SIRT3 Pathway
Shuyue KANG ; Yanzi YU ; Jiaqun SUN ; Wenxuan CHEN ; Yaqin YANG ; Qi WANG ; Weirong LI ; Limei YAO
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):15-24
ObjectiveTo explore the effects of different dosage forms of Kaixinsan (KXS) on the morphology and function of mitochondria in rat models of Alzheimer's disease (AD) and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group, model group, treatment groups receiving KXS decoction, powders, and granules (3.08 g·kg-1), as well as donepezil group (0.51×10-3 g·kg-1), with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin (STZ). After 30 days of administration, behavioral assessments were conducted, and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay (ELISA). Changes in mitochondrial membrane potential were measured via JC-1 staining, and superoxide dismutase (SOD) activity and reactive oxygen species (ROS) levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase (AMPK), peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α), and silent information regulator 3 (SIRT3) was detected by real-time fluorescent quantitative polymerase chain reaction (Real-time PCR), and Western blot was used to examine the protein expression levels of optic atrophy protein1 (OPA1), mitochondrial fission protein 1 (FIS1), AMPK, p-AMPK, PGC-1α, and SIRT3. ResultsCompared with the sham group, rats in the model group had significantly lower recognition index, spontaneous alternation rate, escape latency, number of platform crossings, time spent in the target quadrant, and percentage of distance traveled in the target quadrant distance (P<0.05, P<0.01). Significant mitochondrial damage was observed in the hippocampal tissue, with a marked decrease in mitochondrial respiratory chain complex content (P<0.01) and reduced mitochondrial membrane potential (P<0.05). Additionally, the SOD activity was reduced, while ROS levels were elevated (P<0.01). The mRNA expression of PGC-1α and SIRT3 was significantly downregulated (P<0.01), along with decreased protein expression levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, whereas FIS1 protein expression was significantly upregulated (P<0.05, P<0.01). Compared with the model group, rats in KXS-treated groups (various dosage forms) showed significant improvement in behavioral indexes (P<0.05, P<0.01), reduced hippocampal mitochondrial damage, and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased (P<0.05, P<0.01), and mitochondrial membrane potentials were elevated (P<0.05). SOD activity was elevated, and ROS levels were significantly reduced (P<0.05, P<0.01). Furthermore, the mRNA expression of PGC-1α and SIRT3 was upregulated, with increased protein levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, while FIS1 protein expression levels were significantly reduced (P<0.05, P<0.01). Across the KXS-treated groups, the granule group showed a higher spontaneous alternation rate than the decoction and powder groups (P<0.05). ConclusionKXS decoction, powders, and granules can improve the learning and memory ability of rats, with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway, improvement of the mitochondrial function, and subsequent amelioration of the brain energy metabolism disorders.
6.Effect of Shenxiong Huanglian Jiedu Decoction on Neuronal Damage and Aβ Clearance in Mice Model of Alzheimer's Disease
Jing LIU ; Kang CHEN ; Yushun ZHOU ; Zhezuo ZHANG ; Guran YU ; Hao LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):43-52
ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein (Aβ) and neuronal damage in the mouse model of Alzheimer's disease (AD). MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study, and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group, a sham operation group, a model group, low- and high-dose (3.27,6.54 g·kg-1, respectively) Shenxiong Huanglian Jiedu decoction groups, and a positive control (donepezil hydrochloride, 0.65 mg·kg-1) group. At the end of the drug intervention, the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally, in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid, and staining of ionized calcium-binding adapter molecule-1 (Iba-1) was employed to assess microglial activation in the hippocampal tissue. Additionally, neurotrophin-3 (NT-3) and brain-derived neurotrophic factor (BDNF) levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group, the escape latency of the mice in the model group was prolonged, the platform residence time was shortened, the hippocampal tissue showed pathological manifestations such as neuronal pyknosis, Nissl body dissolution, and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down, and the expression levels of BDNF, NT-3, and interleukin-10 (IL-10) in the hippocampus were significantly decreased (P<0.01). The expression levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), Toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88) and phosphorylated nuclear transcription factor-κB (p-NF-κB p65) in hippocampus were significantly increased (P<0.05, P<0.01). Compared with the model group, the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened, and the platform residence time was prolonged. Neuronal karyopyknosis, Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased (P<0.01), and the expression of TLR4, MyD88 and p-NF-κB p65 was significantly decreased (P<0.05, P<0.01). The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased (P<0.05), and the expression of IL-10 was significantly increased (P<0.05). The expression of TNF-α, IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased (P<0.05, P<0.01). ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD, thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation, reduction of inflammation, and modulation of the TLR4/MyD88/NF-κB signaling pathway.
7.Mechanism of Different Dosage Forms of Kaixinsan in Improving Mitochondrial Function for Prevention and Treatment of Cognitive Disorder Based on AMPK/PGC-1α/SIRT3 Pathway
Shuyue KANG ; Yanzi YU ; Jiaqun SUN ; Wenxuan CHEN ; Yaqin YANG ; Qi WANG ; Weirong LI ; Limei YAO
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):15-24
ObjectiveTo explore the effects of different dosage forms of Kaixinsan (KXS) on the morphology and function of mitochondria in rat models of Alzheimer's disease (AD) and potential mechanisms of action. MethodsMale SD rats were randomly assigned to a sham group, model group, treatment groups receiving KXS decoction, powders, and granules (3.08 g·kg-1), as well as donepezil group (0.51×10-3 g·kg-1), with 10 rats in each group. AD model was created using intracerebroventricular injection of streptozocin (STZ). After 30 days of administration, behavioral assessments were conducted, and mitochondrial morphology was observed using transmission electron microscopy. Mitochondrial respiratory chain complex content was measured via enzyme-linked immunosorbent assay (ELISA). Changes in mitochondrial membrane potential were measured via JC-1 staining, and superoxide dismutase (SOD) activity and reactive oxygen species (ROS) levels were measured via biochemical assays. The mRNA expression of adenosine 5'-monophosphate-activated protein kinase (AMPK), peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α), and silent information regulator 3 (SIRT3) was detected by real-time fluorescent quantitative polymerase chain reaction (Real-time PCR), and Western blot was used to examine the protein expression levels of optic atrophy protein1 (OPA1), mitochondrial fission protein 1 (FIS1), AMPK, p-AMPK, PGC-1α, and SIRT3. ResultsCompared with the sham group, rats in the model group had significantly lower recognition index, spontaneous alternation rate, escape latency, number of platform crossings, time spent in the target quadrant, and percentage of distance traveled in the target quadrant distance (P<0.05, P<0.01). Significant mitochondrial damage was observed in the hippocampal tissue, with a marked decrease in mitochondrial respiratory chain complex content (P<0.01) and reduced mitochondrial membrane potential (P<0.05). Additionally, the SOD activity was reduced, while ROS levels were elevated (P<0.01). The mRNA expression of PGC-1α and SIRT3 was significantly downregulated (P<0.01), along with decreased protein expression levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, whereas FIS1 protein expression was significantly upregulated (P<0.05, P<0.01). Compared with the model group, rats in KXS-treated groups (various dosage forms) showed significant improvement in behavioral indexes (P<0.05, P<0.01), reduced hippocampal mitochondrial damage, and more organized mitochondrial cristae. Mitochondrial respiratory chain complex content was significantly increased (P<0.05, P<0.01), and mitochondrial membrane potentials were elevated (P<0.05). SOD activity was elevated, and ROS levels were significantly reduced (P<0.05, P<0.01). Furthermore, the mRNA expression of PGC-1α and SIRT3 was upregulated, with increased protein levels of OPA1, p-AMPK/AMPK, PGC-1α, and SIRT3, while FIS1 protein expression levels were significantly reduced (P<0.05, P<0.01). Across the KXS-treated groups, the granule group showed a higher spontaneous alternation rate than the decoction and powder groups (P<0.05). ConclusionKXS decoction, powders, and granules can improve the learning and memory ability of rats, with granules being the most effective. The mechanism of action may involve activation of the AMPK/PGC-1α/SIRT3 signaling pathway, improvement of the mitochondrial function, and subsequent amelioration of the brain energy metabolism disorders.
8.Effect of Shenxiong Huanglian Jiedu Decoction on Neuronal Damage and Aβ Clearance in Mice Model of Alzheimer's Disease
Jing LIU ; Kang CHEN ; Yushun ZHOU ; Zhezuo ZHANG ; Guran YU ; Hao LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(7):43-52
ObjectiveTo investigate the effects of Shenxiong Huanglian Jiedu decoction on the clearance of amyloid β-protein (Aβ) and neuronal damage in the mouse model of Alzheimer's disease (AD). MethodsA total of 36 SPF-grade 2-month-old C57BL/6J mice were used in this study, and the modeling was performed by bilateral hippocampal injection of Aβ oligomers in C57BL/6J mice. The experiment was conducted with a blank group, a sham operation group, a model group, low- and high-dose (3.27,6.54 g·kg-1, respectively) Shenxiong Huanglian Jiedu decoction groups, and a positive control (donepezil hydrochloride, 0.65 mg·kg-1) group. At the end of the drug intervention, the learning and memory abilities and the activities of mice were evaluated by the Morris water maze and open field tests. Brain histopathology was examined by hematoxylin-eosin and Nissl staining. Additionally, in vivo imaging was employed to measure the metabolism of fluorescent Aβ in the cerebrospinal fluid, and staining of ionized calcium-binding adapter molecule-1 (Iba-1) was employed to assess microglial activation in the hippocampal tissue. Additionally, neurotrophin-3 (NT-3) and brain-derived neurotrophic factor (BDNF) levels in the brain tissue and serum were determined by the immunofluorescence assay and enzyme-linked immunosorbent assay. Western blot was conducted to determine the expression of inflammation and pathway-related proteins in the hippocampal tissue. ResultsCompared with the blank group and the sham operation group, the escape latency of the mice in the model group was prolonged, the platform residence time was shortened, the hippocampal tissue showed pathological manifestations such as neuronal pyknosis, Nissl body dissolution, and microglia activation. The metabolic rate of fluorescent Aβ through cerebrospinal fluid was slowed down, and the expression levels of BDNF, NT-3, and interleukin-10 (IL-10) in the hippocampus were significantly decreased (P<0.01). The expression levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), Toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88) and phosphorylated nuclear transcription factor-κB (p-NF-κB p65) in hippocampus were significantly increased (P<0.05, P<0.01). Compared with the model group, the escape latency of mice in the low and high dose groups of Chinese medicine and donepezil group was shortened, and the platform residence time was prolonged. Neuronal karyopyknosis, Nissl body dissolution and microglia activation in hippocampus were improved. Fluorescence Aβ was metabolized faster by cerebrospinal fluid. The expression of BDNF and NT-3 in hippocampus was increased (P<0.01), and the expression of TLR4, MyD88 and p-NF-κB p65 was significantly decreased (P<0.05, P<0.01). The expression of TNF-α in the hippocampus of the high-dose group was significantly decreased (P<0.05), and the expression of IL-10 was significantly increased (P<0.05). The expression of TNF-α, IL-6 and IL-1β in the hippocampus of the donepezil group was significantly decreased (P<0.05, P<0.01). ConclusionShenxiong Huanglian Jiedu decoction may mitigate neuronal damage and enhance cerebrospinal fluid flow in the mouse model of AD, thereby promoting the clearance of Aβ and improving the learning and memory abilities. These beneficial effects are likely mediated through the inhibition of microglial activation, reduction of inflammation, and modulation of the TLR4/MyD88/NF-κB signaling pathway.
9.Analysis of expression levels of endoplasmic reticulum stress and trophoblast apoptosis-related markers in placental tissues of early and late-onset severe preeclampsia
Fen Kang ; Yongyuan Wu ; Xiaolan Li
Acta Universitatis Medicinalis Anhui 2025;60(1):102-108
Objective:
To explore the correlation between the expression levels of endoplasmic reticulum stress(ERS) and trophoblast apoptosis-related markers and severe preeclampsia(SPE) in placental tissues of pregnant women with early-and late-onset SPE and normal pregnancy.
Methods:
Placental tissues from 20 early and late haired severe preeclamptic singleton pregnant women who attended the Hospital were collected(early-onset group, late-onset group), and 20 cases pregnant women of normal blood pressure and no other pregnancy complications who delivered in our hospital during the same period were selected as the normal group. Transmission electron microscopy was used to observe the ultrastructure of the endoplasmic reticulum of trophoblast cells in placental tissues. Protein blotting assay was used to detect the expression levels of endoplasmic reticulum stress-related proteins, including Glucose-regulated protein 78(GRP78), C/EBP homologous protein(CHOP), Phosphorylated eukaryotic translation initiation factor 2α(p-eIF2α) and Phosphatidylinositol-requiring enzyme 1(p-IRE1)α. Immunohistochemistry assay was used to detect the expression of proliferating cell nuclear antigen(Ki67), a proliferation marker, in placental tissues, and TUNEL staining was used to detect placental tissue trophoblast apoptosis.
Results:
The endoplasmic reticulum of trophoblast cells in the placental tissues of the normal pregnant women group was normal in volume, with no dilatation or swelling. In contrast, the endoplasmic reticulum of placental tissues in the severe preeclampsia group showed obvious edema and significant dilatation, and the dilatation was more obvious in the early-onset group than in the late-onset group. The expression level of endoplasmic reticulum stress-related proteins GRP78(P<0.001,P<0.05) and CHOP(P<0.01,P<0.001), the phosphorylation levels of eIF2α(P<0.000 1,P<0.01) and IRE1α(P<0.000 1,P<0.001) increased in placental tissues of both early-onset and late-onset groups compared to those of the normal group. The p-eIF2α/eIF2α(P<0.001) to p-IRE1α/IRE1α ratio(P<0.05) and GRP78(P<0.01) protein expression levels were significantly higher in the early-onset group than in the late-onset group. Compared with the normal group, the number of Ki67-positive cells per field of view was significantly reduced in the early-onset and late-onset groups(P<0.000 1,P<0.05), and the number of Ki67-positive cells was significantly lower in the early-onset group than in the late-onset group(P<0.01). There were more positive apoptotic cells per field of view in the placental tissues of the early-onset group, and the apoptosis rate of trophoblast cells was significantly higher than that in the other two groups(P<0.001,P<0.01).
Conclusion
Increased trophoblast apoptosis and suppressed proliferation in placental tissues of patients with severe preeclampsia may be associated with endoplasmic reticulum stress overactivation, and the activation level is higher in placental tissues of early-onset severe preeclampsia than that of late-onset group.
10.Research advances in the disease burden of viral hepatitis in China
Jian LI ; Fuzhen WANG ; Zhongdan CHEN ; Jinlei QI ; Ailing WANG ; Fanghui ZHAO ; Yuanyuan KONG ; Jing SUN ; Jiaqi KANG ; Zundong YIN ; Zhongfu LIU ; Jidong JIA ; Yu WANG
Journal of Clinical Hepatology 2025;41(2):221-227
Over the past three decades, China has made significant progress in the prevention and control of viral hepatitis, and the incidence rates of new-onset pediatric hepatitis B virus infections and acute viral hepatitis in the population have reduced to a relatively low level; however, there is still a heavy disease burden of chronic viral hepatitis in China, which severely affects the health status of the population. This study systematically summarizes the achievements of viral hepatitis prevention and control in China, analyzes existing problems and challenges, and proposes comprehensive prevention and control strategies and measures to eliminate viral hepatitis as a public health threat based on the national conditions of China, in order to provide a reference for related departments in China on how to achieve the action targets for eliminating viral hepatitis as a public health threat by 2030.


Result Analysis
Print
Save
E-mail