2.Experimental and Clinical Study on Detection of Medically Important Fungi by PCR with A Universal Fungus-specific Primer System
Hong ZHANG ; Shaoxi WU ; Ningru GUO
Chinese Journal of Dermatology 1994;0(05):-
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
5.Effect of Alisol Monoacetate A and B on Metabolism of Cholesterol in HepG2 Cell Line
Shuisheng WU ; Gaige GUO ; Hong SHI ; Hong WANG ; Lee DAVID
China Journal of Traditional Chinese Medicine and Pharmacy 2005;0(07):-
Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.
6.Nursing care of massive whole lung lavage in the treatment of pneumoconiosis.
Yu-Hua CHEN ; Xiao-Qing ZHENG ; Guo-Wu HONG
Chinese Journal of Industrial Hygiene and Occupational Diseases 2011;29(8):616-617
Adult
;
Bronchoalveolar Lavage
;
nursing
;
Female
;
Humans
;
Male
;
Middle Aged
;
Pneumoconiosis
;
nursing
;
therapy
;
Retrospective Studies
7.Mechanism of the dentino-enamel junction on the resist-crack propagation of human teeth by the finite element method.
Jingjing ZHENG ; Tiezhou HOU ; Hong TAO ; Xueyan GUO ; Cui WU
West China Journal of Stomatology 2014;32(5):464-466
OBJECTIVEThis study aims to identify the crack tip stress intensity factor of the propagation process, crack propagation path, and the changes in the shape of the crack tip by the finite element method.
METHODSThe finite element model of dentino-enamel junction was established with ANSYS software, and the length of the initial crack in the single edge was set to 0.1 mm. The lower end of the sample was fixed. The tensile load of 1 MPa with frequency of 5 Hz was applied to the upper end. The stress intensity factor, deflection angle, and changes in the shape of the crack tip in the crack propagation were calculated by ANSYS.
RESULTSThe stress intensity factor suddenly and continuously decreased in dentino-enamel junction as the crack extended. A large skewed angle appeared, and the stress on crack tip was reduced.
CONCLUSIONThe dentino-enamel junction on human teeth may resist crack propagation through stress reduction.
Dental Enamel ; Dentin ; Humans ; Stress, Mechanical ; Tooth Fractures
8.Effect of dexmedetomidine on permeability of blood-brain barrier in rats subjected to global cerbral ischemia-reperfusion
Peipei GUO ; Hong YAN ; Jingli CHEN ; Huisheng WU ; Shiying YUAN
Chinese Journal of Anesthesiology 2013;33(6):758-760
Objective To evaluate the effects of dexmedetomidine on the permeability of blood-brain barrier in rats subjected to global cerebral ischemia-reperfusion (I/R).Methods Thirty-six male Sprague-Dawley rats,weighing 250-300 g,were randomly divided into 3 groups (n =12 each):sham operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral I/R was induced by occlusion of bilateral common carotid arteries combined with hypotension (MAP was maintained at 35-45 mm Hg) in anesthetized rats.In group D,dexmedetomidine was infused at a rate of 3μg· kg-1 · h-1 until 2 h of reperfusion after a loading dose of dexmedetomidine 3 μg/kg was injected intravenously immediately after onset of I/R.The rats were sacrificed at 24 h of reperfusion and their brains were immediately removed for microscopic examination of hippocampal CA1 region and for determination of the cell apoptosis,brain water content,Evans blue content and aquaporin 4 (AQP4) expression.Results The number of apoptotic cells was significantly larger,and brain water content,Evans blue content and AQP4 expression were higher in groups I/R and D than in group S (P < 0.05 or 0.01).The number of apoptotic cells was significantly smaller,and brain water content,and Evans blue content and AQP4 expression were lower in group D than in group I/R (P < 0.05 or 0.01).Global cerebral I/R-induced pathological changes were significantly attenuated in group D.Conclusion Dexmedetomidine can decrease the permeability of blood-brain barrier and attenuate global cerebral I/R injury in rats,and down-regulation of AQP4 expression may be involved in the mechanism.
9.Effects of dexmedetomidine on global cerebral ischemia-reperfusion injury in rats
Peipei GUO ; Hong YAN ; Shiying YUAN ; Huisheng WU ; Jingli CHEN
Chinese Journal of Anesthesiology 2011;31(10):1264-1267
Objective To investigate the effects of dexmedetomidine on global cerebral ischemia-reperfusion (I/R) injury in rats.Methods Fifty-four adult male SD rats weighing 200-250 g were randomly divided into 3 groups (n =18 each): shame operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral I/R was produced by occlusion of bilateral common carotid arteries combined with hypotension (MAP maintained at 35-45 mm Hg).In group D dexmedetomidine 3 μg/kg was injected iv immediately after I/R,followed by infusion of dexmedetomidine at a rate of 3 μg· kg- 1 · h- 1 until 2 h of reperfusion.The neurological deficit score (NDS) was assessed (0 =normal,100 =brain death) at 6 h (T1),24 h (T2)and 72 h (T3) of reperfusion.Then six rats were sacrificed in each group and brain tissues were removed for microscopic examination of hippocampus CA1 region and determination of activity of myeloperoxidase (MPO),contents of TNF-α and IL-1β and expression of glial fibrillary acidic protein ( GFAP).Results Compared with group S,NDS,MPO activity and the contents of TNF-α and IL-1β at T1-3 were significantly increased,the expression of GFAP was up-regulated at T2,3 in groups I/R and D ( P < 0.05 or 0.01).Compared with group I/R,NDS,MPO activity and TNF-α concent were significantly decreased at T1-3,IL-1β concent was decreased at T1,2,the expression of GFAP was down-regulated at T2,3 in group D (P < 0.05 or 0.01 ).The pathologic changes were significantly attenuated in group D as compared with group I/R.Conclusion Dexmedetomidine can attenuate global cerebral I/R injury in rats,and the inhibition of inflammatory response may be involved in the mechanism.
10.Impact of multifactor intensive nursing intervention on chronic heart failure patients with outside hospital treatment
Tie LI ; Lilan GUO ; Hong PENG ; Huaying WU ; Jie DONG
Chinese Journal of Practical Nursing 2013;29(34):24-26
Objective To observe the efficacy of multifactor intensive nursing intervention on chronic heart failure patients with outside hospital treatment,including self-management ability and related clinical indicators.Methods By application of prospective study,a total of 215 patients with chronic heart failure discharged from hospital were randomized into the usual care group (105 cases) and the intensive nursing intervention group (1 10 cases).Patients were followed up for 12 months,and 205 patients completed the follow-up.The usual care group only received conventional outpatient follow-up,the intensive intervention group patients received telephone counseling,more detailed clinical follow-up and regular health education.The intervention effect was compared between two groups.Results Compared with the usual care group,the passing rate of sodium/water limit and daily monitoring of weight was higher in the intensive intervention group.Left ventricular ejection fraction and six-minute walking test were better in the intensive intervention group,while the level of NT-pro-BNP was lower in the intensive intervention group.Compared with the usual care group,re-hospitalization rate and incidence of cardiovascular events were lower in the intensive intervention group.Conclusions Multifactor intensive nursing intervention is helpful on improving self-management ability,alleviate cardiac function,reduce re-hospitalization rate and incidence of cardiovascular events for chronic heart failure patients.