Aortopulmonary Septal Defect ; therapy ; Catheterization ; Female ; Humans ; Infant

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Adult ; Female ; Health Knowledge, Attitudes, Practice ; Health Promotion ; Humans ; Lead ; Male ; Middle Aged ; Occupational Exposure ; prevention & control ; Occupational Health ; Occupational Health Services ; Stearates ; Young Adult

Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.

Objective To investigate the diagnosis and the effect of microsurgery in patients with acute spontaneous spinal epidural hematoma (ASSEH). Method Five patients with ASSEH treated with microsurgery and confirmed pathologically were retrospectively analyzed. Results The main clinical presentations were root pain and palsy. The main manifestations of MRI were long-segment epidural lesion of high intensity in T1 and T2-weighted images without enhancement. With the microsurgery system, laminectomy via posterior approach and hematoma removal were successfully undergone with full recovery in all cases. Conclusions MRI assisted with the main clinical symptoms may aid preoperative diagnosis in symptomatic ASSEH. Microsurgery is an effective method for treating ASSEH. Postoperative (rather than preoperative) spinal DSA is advantageous for exclusion of spinal vascular malformation in treating ASSEH.

Child ; Collagen Type IV ; Female ; Humans ; Immunohistochemistry ; methods ; Kidney ; pathology ; Male ; Nephritis, Hereditary ; diagnosis ; pathology

Objective To explore the expression and the role of Toll-like receptor(TLR3 and TLR4) in rats with nephrotic syndrome induced by respiratory syncytial virus(RSV).Methods SD rats were inoculated intranasally and intraperitoneally with 6?106 plaque for-ming unit(PFU) RSV to construct RSV-induced nephropathy in rat model.Rats were anesthetized and blood was withdrawn from cardiac on day 4,14,30,60 after inoculation.The normal ones without intervention were set as control group.The renal histology was observed by light microscope and electron microscope.The urinary protein collected in 24 hours were measured.Meanwhile,the expressions of TLR3 and TLR4 were detected by indirect immunofluorescence staining and flow cytometry in peripheral blood mononuclear cells of rats.The results were analyzed by SPSS 13.0 softwore.Results After inoculation,the proteinuria increased and under the electron microscope the foot processes of glomerular epithelial cells were fused which resembled human minimal change nephrotic syndrome.Proteinuria reached the peak and the fusion of foot processes were most extensive in rats of RSV at 60 d.The expressions of TLR3 and TLR4 in each group of RSV-induced nephropathy in rat models were significantly higher than those in normal control group(Pa0.05).Conclusions TLR3 and TLR4 in peripheral blood mononuclear cells of RSV-induced nephropathy rat mo-dels had being significantly activated until 60 d after RSV inoculation.TLR signaling pathway may play an important role in nephrotic syndrome of rats induced by RSV.

Objective To explore the influence of homocysteine(Hcy)on liver cystathionine-?-synthase(CBS)and methylenetetrahydrofolate reductase(MTHFR)system in apoE-/- mice,and determine the effects of atorvastatin and/or folate/vitamin B12 on liver CBS and MTHFR system.Methods Eighty male 6-week-old apoE-/- mice were randomly divided into two groups:65 mice were fed with a chow diet containing 2%(wt/vol)L-methionine(homomethionine group)and 15 mice were fed with normal saline(control group).Two months later,the 60 mice survived in homomethionine group were subdivided into four groups:group Ⅰ(untreated),Ⅱ(3 mg/kg atorvastatin),Ⅲ(3 mg/kg atorvastatin+2 mg/kg folate+30 ?g/kg vitamin B12)and Ⅳ(2 mg/kg folate+30 ?g/kg vitamin B12).After one month,Western blotting was performed to detect the liver CBS and MTHFR system protein expression in each group.Results The relative expression of liver CBS and MTHFR was significantly lower in group Ⅰ than in control group(P

ADP-ribosyl Cyclase 1 ; immunology ; Biopsy ; Bone Marrow ; immunology ; pathology ; Epoxy Resins ; Humans ; Immunohistochemistry ; Ki-67 Antigen ; immunology ; Plastic Embedding ; Staining and Labeling ; methods