1.Epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome in Zhejiang Province
LÜ ; Jing ; XU Xinying ; QIAO Yingyi ; SHI Xinglong ; YUE Fang ; LIU Ying ; CHENG Chuanlong ; ZHANG Yuqi ; SUN Jimin ; LI Xiujun
Journal of Preventive Medicine 2026;38(1):10-14
Objective:
To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control.
Methods:
Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence.
Results:
A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk.
Conclusions
SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.
2.Effect of mild hypercapnia during the recovery period on the emergence time from total intravenous anesthesia: a randomized controlled trial
Lan LIU ; Xiangde CHEN ; Qingjuan CHEN ; Xiuyi LU ; Lili FANG ; Jinxuan REN ; Yue MING ; Dawei SUN ; Pei CHEN ; Weidong WU ; Lina YU
Korean Journal of Anesthesiology 2025;78(3):215-223
Background:
Intraoperative hypercapnia reduces the time to emergence from volatile anesthetics, but few clinical studies have explored the effect of hypercapnia on the emergence time from intravenous (IV) anesthesia. We investigated the effect of inducing mild hypercapnia during the recovery period on the emergence time after total IV anesthesia (TIVA).
Methods:
Adult patients undergoing transurethral lithotripsy under TIVA were randomly allocated to normocapnia group (end-tidal carbon dioxide [ETCO2] 35–40 mmHg) or mild hypercapnia group (ETCO2 50-55 mmHg) during the recovery period. The primary outcome was the extubation time. The spontaneous breathing-onset time, voluntary eye-opening time, and hemodynamic data were collected. Changes in the cerebral blood flow velocity in the middle cerebral artery were assessed using transcranial Doppler ultrasound.
Results:
In total, 164 patients completed the study. The extubation time was significantly shorter in the mild hypercapnia (13.9 ± 5.9 min, P = 0.024) than in the normocapnia group (16.3 ± 7.6 min). A similar reduction was observed in spontaneous breathing-onset time (P = 0.021) and voluntary eye-opening time (P = 0.008). Multiple linear regression analysis revealed that the adjusted ETCO2 level was a negative predictor of extubation time. Middle cerebral artery blood flow velocity was significantly increased after ETCO2 adjustment for mild hypercapnia, which rapidly returned to baseline, without any adverse reactions, within 20 min after extubation.
Conclusions
Mild hypercapnia during the recovery period significantly reduces the extubation time after TIVA. Increased ETCO2 levels can potentially enhance rapid recovery from IV anesthesia.
3.Surveillance results of respiratory syncytial virus outbreaks in kindergarten and school in Shenzhen, 2017-2023
WANG Xin, FANG Shisong, WU Weihua, LIU Hui, SUN Ying, ZOU Xuan, TANG Xiujuan
Chinese Journal of School Health 2025;46(3):435-437
Objective:
To analyze respiratory syncytial virus(RSV) outbreaks surveillance results and the epidemiological characteristics in kindergarten and school in Shenzhen during 2017-2023 , so as to provide a scientific reference for control and prevention of RSV.
Methods:
Epidemiological data and surveillance results of RSV outbreaks in kindergarten and school from 2017 to 2023 were collected for descriptive analyses.
Results:
A total of 31 RSV outbreaks were identified in kindergarten and school in 2017-2023 in Shenzhen, 346 cases were reported, the average incidence rate was 22.02%. The most annual RSV outbreaks were reported in 2020 with 14 outbreaks, followed by 8 outbreaks in 2023. A total of 64.52% of RSV outbreaks were identified in kindergarten with rest occurring in primary school or middle school. The greatest monthly count of outbreak was 18 (58.06%) in September, followed by 3 outbreaks (9.68%) in March and October. A total of 244 swab samples were collected, 169 samples were positive for respiratory viruses, the positive rate was 69.26%, 121 samples were positive for RSV,from 31 respiratory syncytical virus outbreaks 57 and samples were positive for other respiratory viruses(9 samples were positive for two respiratory viruses). A toral of 14(45.16%) outbreaks are caused by RSV alone, 17 outbreaks (54.84%) were caused by RSV and other respiratory viruses.
Conclusions
Most RSV outbreaks in kindergarten and school are reported after 2020 in Shenzhen, most RSV outbreaks occur in kindergarten, peak seasons of RSV outbreaks are autumn and spring.
4.Effect of mild hypercapnia during the recovery period on the emergence time from total intravenous anesthesia: a randomized controlled trial
Lan LIU ; Xiangde CHEN ; Qingjuan CHEN ; Xiuyi LU ; Lili FANG ; Jinxuan REN ; Yue MING ; Dawei SUN ; Pei CHEN ; Weidong WU ; Lina YU
Korean Journal of Anesthesiology 2025;78(3):215-223
Background:
Intraoperative hypercapnia reduces the time to emergence from volatile anesthetics, but few clinical studies have explored the effect of hypercapnia on the emergence time from intravenous (IV) anesthesia. We investigated the effect of inducing mild hypercapnia during the recovery period on the emergence time after total IV anesthesia (TIVA).
Methods:
Adult patients undergoing transurethral lithotripsy under TIVA were randomly allocated to normocapnia group (end-tidal carbon dioxide [ETCO2] 35–40 mmHg) or mild hypercapnia group (ETCO2 50-55 mmHg) during the recovery period. The primary outcome was the extubation time. The spontaneous breathing-onset time, voluntary eye-opening time, and hemodynamic data were collected. Changes in the cerebral blood flow velocity in the middle cerebral artery were assessed using transcranial Doppler ultrasound.
Results:
In total, 164 patients completed the study. The extubation time was significantly shorter in the mild hypercapnia (13.9 ± 5.9 min, P = 0.024) than in the normocapnia group (16.3 ± 7.6 min). A similar reduction was observed in spontaneous breathing-onset time (P = 0.021) and voluntary eye-opening time (P = 0.008). Multiple linear regression analysis revealed that the adjusted ETCO2 level was a negative predictor of extubation time. Middle cerebral artery blood flow velocity was significantly increased after ETCO2 adjustment for mild hypercapnia, which rapidly returned to baseline, without any adverse reactions, within 20 min after extubation.
Conclusions
Mild hypercapnia during the recovery period significantly reduces the extubation time after TIVA. Increased ETCO2 levels can potentially enhance rapid recovery from IV anesthesia.
5.Effect of mild hypercapnia during the recovery period on the emergence time from total intravenous anesthesia: a randomized controlled trial
Lan LIU ; Xiangde CHEN ; Qingjuan CHEN ; Xiuyi LU ; Lili FANG ; Jinxuan REN ; Yue MING ; Dawei SUN ; Pei CHEN ; Weidong WU ; Lina YU
Korean Journal of Anesthesiology 2025;78(3):215-223
Background:
Intraoperative hypercapnia reduces the time to emergence from volatile anesthetics, but few clinical studies have explored the effect of hypercapnia on the emergence time from intravenous (IV) anesthesia. We investigated the effect of inducing mild hypercapnia during the recovery period on the emergence time after total IV anesthesia (TIVA).
Methods:
Adult patients undergoing transurethral lithotripsy under TIVA were randomly allocated to normocapnia group (end-tidal carbon dioxide [ETCO2] 35–40 mmHg) or mild hypercapnia group (ETCO2 50-55 mmHg) during the recovery period. The primary outcome was the extubation time. The spontaneous breathing-onset time, voluntary eye-opening time, and hemodynamic data were collected. Changes in the cerebral blood flow velocity in the middle cerebral artery were assessed using transcranial Doppler ultrasound.
Results:
In total, 164 patients completed the study. The extubation time was significantly shorter in the mild hypercapnia (13.9 ± 5.9 min, P = 0.024) than in the normocapnia group (16.3 ± 7.6 min). A similar reduction was observed in spontaneous breathing-onset time (P = 0.021) and voluntary eye-opening time (P = 0.008). Multiple linear regression analysis revealed that the adjusted ETCO2 level was a negative predictor of extubation time. Middle cerebral artery blood flow velocity was significantly increased after ETCO2 adjustment for mild hypercapnia, which rapidly returned to baseline, without any adverse reactions, within 20 min after extubation.
Conclusions
Mild hypercapnia during the recovery period significantly reduces the extubation time after TIVA. Increased ETCO2 levels can potentially enhance rapid recovery from IV anesthesia.
6.Effect of mild hypercapnia during the recovery period on the emergence time from total intravenous anesthesia: a randomized controlled trial
Lan LIU ; Xiangde CHEN ; Qingjuan CHEN ; Xiuyi LU ; Lili FANG ; Jinxuan REN ; Yue MING ; Dawei SUN ; Pei CHEN ; Weidong WU ; Lina YU
Korean Journal of Anesthesiology 2025;78(3):215-223
Background:
Intraoperative hypercapnia reduces the time to emergence from volatile anesthetics, but few clinical studies have explored the effect of hypercapnia on the emergence time from intravenous (IV) anesthesia. We investigated the effect of inducing mild hypercapnia during the recovery period on the emergence time after total IV anesthesia (TIVA).
Methods:
Adult patients undergoing transurethral lithotripsy under TIVA were randomly allocated to normocapnia group (end-tidal carbon dioxide [ETCO2] 35–40 mmHg) or mild hypercapnia group (ETCO2 50-55 mmHg) during the recovery period. The primary outcome was the extubation time. The spontaneous breathing-onset time, voluntary eye-opening time, and hemodynamic data were collected. Changes in the cerebral blood flow velocity in the middle cerebral artery were assessed using transcranial Doppler ultrasound.
Results:
In total, 164 patients completed the study. The extubation time was significantly shorter in the mild hypercapnia (13.9 ± 5.9 min, P = 0.024) than in the normocapnia group (16.3 ± 7.6 min). A similar reduction was observed in spontaneous breathing-onset time (P = 0.021) and voluntary eye-opening time (P = 0.008). Multiple linear regression analysis revealed that the adjusted ETCO2 level was a negative predictor of extubation time. Middle cerebral artery blood flow velocity was significantly increased after ETCO2 adjustment for mild hypercapnia, which rapidly returned to baseline, without any adverse reactions, within 20 min after extubation.
Conclusions
Mild hypercapnia during the recovery period significantly reduces the extubation time after TIVA. Increased ETCO2 levels can potentially enhance rapid recovery from IV anesthesia.
7.Study on relationships of MS4A1 gene polymorphism with blood concentration and efficacy of rituximab in patients with non-Hodgkin’s lymphoma
Feng SHI ; Tao LIU ; He HUANG ; Caifu FANG ; Shaoxing GUAN ; Zhang ZHANG ; Zhao WANG ; Xiaojie FANG ; Zhuojia CHEN ; Shu LIU
China Pharmacy 2025;36(13):1641-1647
OBJECTIVE To explore the effects of CD20 coding gene (MS4A1) polymorphism on the blood concentration and efficacy of rituximab in patients with non-Hodgkin’s lymphoma. METHODS A prospective observational study was conducted on 160 newly diagnosed non-Hodgkin’s lymphoma patients who received the R-CHOP regimen at the Sun Yat Sen University Cancer Center from January 2016 to December 2020, with a minimum follow-up period of approximately 5 years. The blood concentration of rituximab was detected by enzyme-linked immunosorbent assay. MS4A1 tagSNPs were selected by Haploview4.2 software, including rs1051461, rs17155034, rs4939364, and rs10501385. The genotype of MS4A1 was detected by Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Univariate linear regression analysis was employed to examine the correlation between various factors(demographic, clinical, and genotypic variables) in patients and the steady-state trough concentration of rituximab during the first course of treatment, followed by multivariate linear regression analysis. Kaplan-Meier curves were drawn to evaluate progression-free survival (PFS) and overall survival (OS). Using MS4A1 genotype and tumor stage as independent variables, Cox regression model was employed to evaluate the factors influencing patient prognosis. RESULTS The blood concentration of rituximab in MS4A1 rs10501385 CC carriers was 15.20 μg/mL,which was significantly lower than 21.95 μg/mL in AA+AC carriers (P<0.05). The multivariate linear regression model incorporating tumor stage and MS4A1 rs10501385 polymorphism explained 7.3% of the interindividual variability in rituximab concentrations. Compared with MS4A1 rs1051461 CC carriers, CT+TT carriers had significantly prolonged PFS and OS (P<0.05). The Cox proportional hazards regression model showed that the MS4A1 rs1051461 CC genotype (HR=4.406, 95%CI:1.743-11.137, P<0.05) and tumor Ⅲ&Ⅳ (HR=3.233, 95%CI: 1.413-7.399, P<0.05) were independent risk factors for PFS. CONCLUSIONS The tumor staging and MS4A1 rs10501385 polymorphism are key influencing factors for blood concentration of rituximab, and MS4A1 rs1051461 polymorphism significantly affects PFS in non-Hodgkin’s lymphoma patients.
8.Therapeutic effect and mechanism of hordenine on ovalbumin-induced allergic rhinitis in rats
Junyan LI ; Tao LIU ; Fang SUN ; Jiahui HUANG ; Shuzhen MAO ; Jing YAO
Journal of China Pharmaceutical University 2025;56(1):80-90
To investigate the therapeutic effect and related mechanisms of hordenine on ovalbumin (OVA)-induced allergic rhinitis (AR) in rats, HE and AB-PAS staining were used to detect the improvement of pathological damage to the nasal mucosa induced by hordenine. ELISA was employed to detect the effect of hordenine on OVA-sIgE in serum and IL-4 in the nasal mucosa supernatant of rats. IHC and Western blot experiments were undertaken to examine the effect of hordenine on Th1/Th2 cell balance. Bioinformatics analysis was performed to predict pathways, which were verified by in vivo and in vitro experiments. The experimental results showed that hordenine could alleviate the behavioral manifestations of OVA-induced AR rats, alleviate nasal mucosal pathological damage caused by AR, and reduce the secretion of OVA-sIgE and IL-4. In addition, hordenine could regulate the Th1/Th2 balance. Bioinformatics analysis results showed that the potential pathway of action of hordenine on AR was the phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt) signaling pathway. The in vivo experimental results showed that the expression of PI3K and p-Akt proteins in the nasal mucosa of the model group rats was significantly increased (P < 0.01), and that the protein expression level was significantly decreased after the administration of hordenine, which was also confirmed by an in vitro experiment. This study suggests that hordenine may regulate Th1/Th2 cell balance through the PI3K/Akt signaling pathway, thereby exerting an alleviating effect on OVA-induced AR.
9.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
10.Safety and puncture accuracy of visual dilated sheath combined with needle nephroscope percutaneous nephroscopy for renal calculi
Huaijun LIU ; Shaoshan WU ; Fang CHEN ; Wenlian HU ; Qilin SUN ; Cheng ZHANG ; Tao TAO
Journal of Modern Urology 2025;30(4):300-305
Objective: To compare the clinical efficacy of visual dilated sheath combined with needle nephroscope percutaneous nephrolithotomy (PCNL) with traditional PCNL for renal calculi,so as to enhance the intraoperative safety and puncture accuracy. Methods: A retrospective analysis was conducted on 100 patients with renal calculi treated on hospital during Sep.2022 to Sep.2023.Based on the surgical approaches,patients were divided into the needle nephroscope group (PCNL with visual dilator sheath and needle nephroscope,n=52) and traditional group (traditional PCNL,n=48).Clinical characteristics,surgical parameters,and outcomes were compared between the two groups. Results: There were no significant differences between the two groups in baseline data,total operation time and hospital stay (P>0.05).The needle nephroscope group had a longer channel establishment time compared to the traditional group [20.0(17.0-22.0) min vs.16.0 (15.0-21.0) min,P=0.002],but significantly shorter puncture time [2.0 (1.0-2.6) min vs. 2.8(2.0-3.5) min,P<0.001],and fewer adjustments of the puncture needle (9.6% vs. 64.6%,P<0.001).The channel was successfully established on the first attempt in all patients in the needle nephroscope group,while only 41 of patients in the traditional group achieved success on the first attempt,6 cases needed 2 attempts,and 1 case needed 3 attempts.Postoperative complications were absent in the needle nephroscope group,whereas postoperative bleeding requiring interventional treatment occurred in 1 case in the traditional group.There was no significant difference in the first-stage stone-clearance rate between the two groups (88.4%vs. 85.4%,P=0.872). Conclusion: PCNL using a visual dilator sheath combined with a needle nephroscope achieves a comparable first-stage stone-clearance rate to traditional PCNL.However,it offers significant advantages in terms of shorter puncture time,fewer adjustments of the puncture needle,and lower postoperative complication rate.These findings suggest superior safety and precision,making it a valuable technique for clinical application.


Result Analysis
Print
Save
E-mail