Objective To study pharmacological mechanism of Sanshanxiao granules in treating diabetes. Methods The rat model of diabetes was set up by injecting STZ intraabdominally. The modeled diabetic animals were divided into model group, Sanshanxiao group, and Xiaokewan control group. Normal rats were devised as blank-contrasted group. It was observed through several aspects on the level of blood sugar and insulin, activity changes of SOD in serum, contents of MDA and changes of islets of pancreas morphologic contrastly. Results Sanshanxiao granules can reduce blood sugar, stimulate insulin secreted, develop activity of SOD and decrease the contents of MDA obviously (P

Objective To explore the relationship between mitochondrial DNA deletion and malignant phenotypes of human lung cancer cells. Methods Two rho? derivatives of 95C and 95D were generated by treating the cultured cells with ethidium bromide. Agarose colony formation assays and Transwell invasion assays were carried out to detect the phenotypes of colony formation and invasiveness of the cultured cells, respectively. Cell growth was determined by MTT. Results The partially mtDNA-deleted cells exhibited stronger capacity of colony formation and invasiveness, and faster growth rates than their respective parental cell lines. Conclusion Mitochondrial DNA deletion might play a role in the formation of malignant phenotypes of human lung cancer.

Objective To study the imaging features and adequate interventional therapy of the diffuse type hepatic cellular carcinoma(HCC).Methods Fourteen patients with the diffuse type HCC underwent hepatic angiography and the adequate interventional therapy by TAI or TAE according to imaging appearances,blood supply and function of liver.Results ①Imaging appearances:the most common appearances of fourteen patients with the diffuse type HCC on DSA and CT included:tumor blood vessel was extensive and increased,tumor stain was extensive in left and right liver leaf(such as grain,small spot ,nodule shadows or low density area),liver enlarged obviously with liver cirrhosis,portal vein tumor thrombus,arteriopotal shunt and widespreadly scattered iodized oil,et al.②Therapeutic effect:the mean survival time of fourteen patients was 3 months,the longest survival period was 10 months and the shortest one was olny 15 days.Conclusion ①The specific appearances of the diffuse type HCC are diffuse small spot-like,frosted glass-like,double orbit-like and big liver-like.②The interventional therapeutic effect and prognosis of the diffuse type HCC are the worst than that of other type primary hepatic carcinoma.Selecting adequate interventional therapeutical plan can obviously prolong survival time of the patient.

OBJECTIVE: To investigate the diagnosis applying effects of ocular vestibular evoked myogenic potentials(oVEMP) in peripheral BPPV disease. METHOD: During September 2012 to January 2015, we selected 80 healthy people in our hospital medical center as the control group, choose the same period of primary benign paroxysmal positional vertigo as the observation group of 80 patients. Two groups were carried out fully functional auditory evoked potential analysis, determination of oVEMP and cervical vestibular evoked myogenic potentials (cVEMP) anomaly amplitude threshold, P1 latencies, N1 incubation period. RESULT: The cVEMP abnormal rate in the observation group was 28.8%, the oVEMP abnormal rate was 38.8%, while cVEMP and oVEMP abnormal rates in the control group was 1.3% and 2.5% respectively that compared to significant differences between the two groups (P < 0.05). The oVEMP test amplitude in the observation group was (5.98 ± 2.15) µv, the N1 incubation period was (10.03 ± 0.76)ms, while the control group were (4.09 ± 2.11)µv and (11.67 ± 0.78) ms that compared difference were statistically significant (P < 0.05). The cVEMP test amplitude in the observation group was (154.8 ± 43.9)2 µv, while the control group was (180.49 ± 45.34)µv, compared the difference was statistically significant (P < 0.05). CONCLUSION Paroxysmal positional vertigo patients ocular vestibular evoked myogenic potentials abnormal rate is relatively high, the utricle dysfunction for more severe than the balloon can be the subject of an objective function of the ear stone judgment, judgment in favor of the disease.
Benign Paroxysmal Positional Vertigo ; diagnosis ; Case-Control Studies ; Humans ; Saccule and Utricle ; physiopathology ; Vestibular Evoked Myogenic Potentials

Objective To explore contrast-enhanced ultrasonography (CEUS) in diagnosis renal injuries complicated with active bleeding of different velocity,and analysis the related factors of renal traumatic degree.Methods Thirty-four Ⅰ - Ⅴ grade lesions of renal injury were made in 4 dogs and 6 New Zealand rabbits.Two and three dimensional CEUS were used to observe traumatic extension,and traumatic position,involving in vascular as well.Then the injury condition was classified and assessed synthetically.Results The range of lesions observed by using 2D and 3D ultrasound had consistency with those of the pathologic sample (length-diameter:F =0.4724,P =0.6252; transverse diameter:F =1.6174,P =0.20490),3D-CEUS can display the vascular that involved by renal injury.In the same traumatic extension condition,the time of animal becoming shocked and injury severity was related to not only traumatic extension but also different velocity of active bleeding and involving in vascular.Conclusions Contrastenhanced ultrasound can objectively reflect renal injury severity,and more information can be provided to clinical for management.

Objective To quickly evaluate the traumatic degree of abdominal solid-organs using contrast-enhanced ultrasonography (CEUS) and analysis on related factors with clinical treatment.Methods 52 patients with abdominal traumatic were observed by CEUS,and the traumatic degree was judged according to American Association for the Surgery of Trauma (AAST).The change of peritoneal fluid was observed with ultrasonography,and active bleeding and involve adjacent vessels their branches were observed with CEUS.In this way,a method of quickly evaluate the traumatic degree was established,and the correlation between indifferent grade trauma and appropriate interventions that include surgical and conservative treatment was studied.Results 52 patients with 71 lesions,compound injuries accounted for 82.7％ (43/52).Among them,37 lesions were Ⅰ-Ⅲ grade trauma,34 lesions were severe trauma of Ⅳ-Ⅴ grade.The lesions complicated with active bleeding were 76.1％ (54/71).The amount of peritoneal fluid was increased significantly within 30 min (P ＜0.05) in traumatic lesions with rapid bleeding.Among of 50lesions associated with active bleeding,the surgical treatment was 24.0％ (12/50),the conservative treatment was 76.0％ (38/50).Among of trauma lesions involving the two following vessels,Ⅰ-Ⅲ grade was 97.3％ (36/37),Ⅳ-Ⅴ grade was 61.8％ (21/34).Trauma involvement above level 2 focal blood vessels,surgical treatment accounted for 23.1％ (12/52),conservative treatment accounted for 44.2％(23/52).Conclusions The severity of the trauma can not be a comprehensive response by AAST,becauce it is not only related to the scope of the traumatic lesions,vascular level,also involved with the trauma associated with active bleeding,bleeding speed and amount of peritoneal effusion and other factors.

Objective The purpose of this study was to investigate the differences of cognitive impairment and neuropsychiatric behavior disturbances between Alzheimer's disease (AD) and frontotemporal dementia (FTD) patients,as well as their relationships with dementia severity.Methods A total of 38 FTD patients and 46 AD patients were recruited in this study.The Montreal Cognitive Assessment (MoCA) and Mini-Mental State Examination (MMSE) were used to evaluate the degree of cognitive impairments.The Neuropsychiatric Inventory Brief Questionnaire Form (NPI) and Frontal Behavioral Inventory (FBI) were used to measure behavioral disturbances.The 21-items Hamilton Depression Rating Scale (HAMD-21) was used to evaluate the mental or emotional state of patients.Clinical dementia rating scale (CDR) was used to divide the dementia severity.Results FTD patients were younger ((70.13 ± 8.36) years vs (66.46 ± 7.04) years,t =2.124,P =0.037),earlier at age of onset ((68.58 ± 8.51) years vs (64.43 ± 6.82) years,t =2.396,P =0.019),with lower MoCA scores (12.50 (8.00,16.25) vs 17.00(10.75,21.00),Z=-2.428,P=0.015),higher NPI (15.00(7.00,25.50)vs 9.50(4.00,17.75),Z=-2.251,P=0.024),FBI (21.00(13.00,27.00)vs 16.00(10.75,23.00),Z=-2.159,P=0.031),FBI-A (13.00 (8.00,16.00)vs 9.00(6.00,12.00) Z=-2.159,P=0.041),FBI-B (9.00(7.00,14.00) vs 7.00(3.00,11.00),Z=-2.051,P=0.040) and HAMD-21 scores (7.00(2.75,14.00) vs 5.00 (3.00,8.00),Z =-2.061,P =0.039).A detail analysis of different cognitive domains showed the executive functions (Z =-2.140,P =0.032),language (Z =-3.357,P =0.001),abstraction (Z =-2.498,P =0.012) and delayed recall (Z =-4.317,P =0.000) of the MoCA scale were lower in FTD patients than that in AD patients,while AD patients had lower scores in memory (Z =-1.999,P =0.046) and orientation (Z =-2.941,P =0.003) of the MMSE scale.Within the subscale scores of the NPI,the agitation (Z =-3.255,P =0.001),disinhibition (Z =-3.093,P =0.002) and irritability (Z =-2.214,P =0.027) scores were higher in FTD patients than in AD patients.The total scores of NPI (r=0.279,P=0.010),FBI (r =0.353,P=0.001),FBI-A (r=0.386,P=0.000) and FBI-B (r =0.273,P =0.012) were positively correlated with the CDR scores,whereas MoCA scores were negatively correlated with the CDR scores (r =-0.760,P =0.000).The subscale scores on MoCA and NPI areas changed corresponding with dementia severity in both groups.Conclusions The cognitive function,behavioral and psychological symptoms between FTD and AD patients are different.FTD patients have poorer executive function,language,abstraction and delayed recall ability,whereas AD patients perform worse in memory and orientation.With the progression of the disease,FTD patients gradually emerged disorientation,while the cognitive impairment in AD patients almost affected all the areas.FTD patients are more likely to have agitation,disinhibition and irritability behavior,and AD patients are more likely to have depression in the late stage.Dynamic evaluation of the cognitive function,behavioral and psychological symptoms in clinical practice can help to distinguish FTD and AD.

Liver transplantation is an effective treatment for end-stage chronic liver diseases and acute liver failure. With the rapid development of surgical techniques, organ preservation technology, and pharmacotherapy, patients' survival rates are improved constantly. However, postoperative complications are still major influencing factors for postoperative incidence and mortality rates. Since clinical and laboratory examinations lack specificity and it is difficult to diagnose various postoperative complications, the application of imaging techniques effectively solves such problems. This article summarizes the imaging findings of common complications after liver transplantation, such as vascular complications, biliary complications, liver parenchyma lesions, and postoperative infection, and points out that imaging examinations have significant advantages and can be used for comprehensive evaluation of disease progression.

OBJECTIVE: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction. METHODS: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic. CONCLUSION The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.
Carbohydrate Metabolism, Inborn Errors/genetics* ; Child ; Coloboma ; Female ; Humans ; Microcephaly/genetics* ; Mutation ; Phenotype ; Phosphoglycerate Dehydrogenase/genetics* ; Psychomotor Disorders/genetics* ; Seizures/genetics* ; Whole Exome Sequencing

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype