1.The application of subdermal vascular network skin graft in severed finger reunion with small area skin defects
Chuanchong ZONG ; Yufa WANG ; Heng TIAN ; Guoliang JIA ; Yuxuan LIU
Chinese Journal of Postgraduates of Medicine 2017;40(4):357-359
Objective To explore the application of subdermal vascular network skin graft in severed finger reunion with small area skin defects.Methods Modified subdermal vascular network,which was inversion thin and middle thick,was used to repair defect of severed finger reunion without exposure of blood vessel.There were 10 patients and 14 fingers,including 7 patients and 10 fingers injured in the dorsal sid with 5 fingers' extensor tendon exposed,and 3 patients and 4 fingers injured in the palmar side with 2 patients' flexor tendon exposed.The defect area was ranged from 1.0 cm × 0.8 cm to 3.0 cm × 1.5 cm.Results In 6 larger subdermal vascular network,skin's edge became blue and blister appeared in the middle.The others was good with skin texture and aspect.Conclusions Modified subdermal vascular network skin graft is safe and effective choose to solve severed finger reunion with smnall area skin defects.
2.The anatomical study of contralateral C7 transfer through the vertebral body route
Yufa WANG ; Bin WANG ; Fu LI ; Zhe ZHU ; Youqiong LI ; Lue SU ; Shuangwei ZOU
Chinese Journal of Microsurgery 2009;32(2):133-135
Objective To find the optimal route of eontralateral C7 nerve transfer for brachial plexus avulsion injuries through autopsy. Methods The bilateral brachial plexus were exposed on 30 sides of 15 cadaverie specimens of adult. The C7 nerve root was sectioned at the junction site of trunk and division, and then dissected proximally to the foramina. The max length of anterior and posterior division of C7 was measured. The distance between the roof of C7 and the upper trunk and the lower trunk at the affected side through vertebral body route, prespinal route and a subcutaneous tunnel on the anterior surface of the neck was measured. Results The max length of anterior and posterior division of C7 was (7.67±1.06) cm and (7.79±1.36) cm respectively. The distance between the roof of C7 and the upper trunk at the affected side through vertebral body route, prespinal route and a subcutaneous tunnel on the anterior surface of the neck was (6.97±0.56) cm and (10.04±0.94) cm and (16.56±1.24) cm respectively, there were statistical significance among them (P < 0.01). The distance between the roof of C7 and the lower trunk at the affected side through vertebral body route and prespinal route and a subcutaneous tunnel on the anterior surface of the neck was (6.82±0.92) cm、(9.91±0. 83) cm and (17.64±0.97) cm, with a significant difference (P<0.01). Conclusion The best way of contralateral C7 nerve transfer for the treatment of brachial plexus injury was through the vertebral body route from the point of anatomy.
3.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
4.Detection results from first case of human infection with avian influenza (H5N6) in Hubei Province, China
Xiyun WANG ; Ming HOU ; Yufa MEI ; Qian WANG ; Xiangmei ZHENG ; Weibing YI
Chinese Journal of Zoonoses 2017;33(1):89-91
We analyzed the laboratory detection results from the first case of human infected with avian influenza (H5N6) in Hubei Province,in order to provide a better basis for preventing and controlling human avian influenza in the future and a detected strategy for the detection of suspected cases of human avian influenza for the staff in the laboratory.The case data of epidemiological survey and related laboratory detection results of specimens of infection virus from the different time piont and kinds of specimens were analyzed by descriptive epidemiological methods.The H5N6 nucleic acid from the only early sputum specimens were detected,and while the others were not detected.In conclusion the different specimens of the doubtful H5N6 case should be collected,and the early sputum samples are very important and should be collected and detected.
5.Effects of Yupingfeng Powder on Th1/Th2 balanace in murine model of allergic rhinitis
Jun GU ; Chaobin SHEN ; Lei LU ; Qiang DAI ; Kuangcheng XIE ; Shengrong ZHONG ; Yufa WANG
Chinese Traditional Patent Medicine 1992;0(08):-
AIM: To study the effect of Yupingfeng Powder(YPFP) on rat's allergic rhinitis induced by stimulating ovalbumin.and reveal the influence on Th1,Th2 and Th1/Th2 proportion. METHODS: 8-week-old BALB/c mice were sensitized by means of intranasal and systemic intraperitoneal injection application of OVA,6 subjects were administered including 2,500 mg/kg extracts of YPFP for 7 days in early stage(interference group);6 mice were administered YPFP in after challenge(therapy group);the placebo group were given saline.After 7 days,Th1 and Th2 in splenocyte were detected by flow cytometry(FCM) and nasobuccal mucosa pathology were observed. RESULTS: When compared with Th2 of animal model group(9.86?1.40),there was a significant decrease expressing Th2 after PFP treatment(3.41?0.72,P
6.Experimental study on the viscoelastic properties of cancellous bone of the os calcaneus, os lunatum and os capitalum.
Yufa WANG ; Zhongjun ZHANG ; Fazhi HEI ; Hongshun MA
Journal of Biomedical Engineering 2003;20(3):434-438
We have researched the viscoelastic properties of the cancellous bones of the os calcaneus, os lunatum and os capitalum. The compressing stress relaxation experiment and the creep experiment in the vertical, horizontal and 45 degree directions on the os calcaneus were performed. The data and curve of the compressing stress relaxation and creep were obtained. By masing regression analysis we worked out the compressing reduced stress relaxation and creep functions and curves. The results show that the quantities of compressing stress relaxation and creep of the calcaneus in the vertical direction are larger than those in the other two directions. The initial quantities of creep of the os capitalum are larger than those of the os lunatum, and there are no significant different between the quantities of stress relaxation of the cancellous bones of the os lunatum and os capitalum.
Adult
;
Calcaneus
;
physiology
;
Elasticity
;
Humans
;
Linear Models
;
Lunate Bone
;
physiology
;
Male
;
Models, Biological
;
Regression Analysis
;
Skull
;
physiology
;
Stress, Mechanical
;
Weight-Bearing
;
physiology
7.Expression of asparagine synthetase in relapsed or refractory extranodal NK/T cell lymphoma
Shaojie WU ; Yufa LI ; Yujue WANG
Journal of Southern Medical University 2017;37(4):465-469
Objective To detect the expression level of asparagine synthetase (ASNS) in patients with relapsed or refractory extranodal NK/T cell lymphoma and explore its clinical significance. Methods Ten patients with relapsed or refractory extranodal NK/T cell lymphoma admitted in our department from January, 2013 to January, 2016 were analyzed. The diagnoses were confirmed by pathological and immunohistochemical examination following failed chemotherapies in all cases. Branched DNA-liquidchip technique (bDNA-LCT) was used for detecting ASNS mRNA expression in paraffin-embedded tissue sections in the 10 cases of relapsed or refractory extranodal NK/T cell lymphoma and in 5 cases of chronic rhinitis. The correlations were analyzed between ASNS expression and the clinicopathological features and outcomes of the patients with failed chemotherapy regimens containing asparaginasum. Results Six out of the 10 patients with relapsed or refractory extranodal NK/T cell lymphoma died due to diseaseprogression. The expression level of ASNS was significantly higher in the lymphoma tissues than in tissue specimens of chronic rhinitis (P<0.05). The expression level of ASNS was associated with the International Prognostic Index (P=0.023) in patients with relapsed or refractory extranodal NK/T cell lymphoma, and Kaplan-Meier curve showed that a high ASNS expression was correlated with a reduced overall survival and progression-free survival of the patients. Conclusion Asparaginasum-based chemotherapy regimens are recommended for treatment of relapsed or refractory extranodal NK/T cell lymphoma with low ASNS expressions.
8.Expression of asparagine synthetase in relapsed or refractory extranodal NK/T cell lymphoma
Shaojie WU ; Yufa LI ; Yujue WANG
Journal of Southern Medical University 2017;37(4):465-469
Objective To detect the expression level of asparagine synthetase (ASNS) in patients with relapsed or refractory extranodal NK/T cell lymphoma and explore its clinical significance. Methods Ten patients with relapsed or refractory extranodal NK/T cell lymphoma admitted in our department from January, 2013 to January, 2016 were analyzed. The diagnoses were confirmed by pathological and immunohistochemical examination following failed chemotherapies in all cases. Branched DNA-liquidchip technique (bDNA-LCT) was used for detecting ASNS mRNA expression in paraffin-embedded tissue sections in the 10 cases of relapsed or refractory extranodal NK/T cell lymphoma and in 5 cases of chronic rhinitis. The correlations were analyzed between ASNS expression and the clinicopathological features and outcomes of the patients with failed chemotherapy regimens containing asparaginasum. Results Six out of the 10 patients with relapsed or refractory extranodal NK/T cell lymphoma died due to diseaseprogression. The expression level of ASNS was significantly higher in the lymphoma tissues than in tissue specimens of chronic rhinitis (P<0.05). The expression level of ASNS was associated with the International Prognostic Index (P=0.023) in patients with relapsed or refractory extranodal NK/T cell lymphoma, and Kaplan-Meier curve showed that a high ASNS expression was correlated with a reduced overall survival and progression-free survival of the patients. Conclusion Asparaginasum-based chemotherapy regimens are recommended for treatment of relapsed or refractory extranodal NK/T cell lymphoma with low ASNS expressions.
9.A cross sectional survey on the prevalence of food intolerance and its determinants through physical checkup programs in the elderly
Yan WANG ; Xiaoyong SAI ; Yufa SUN ; Yansong ZHENG
Chinese Journal of Epidemiology 2014;35(11):1249-1251
Objective To explore the prevalence of food intolerance and its determinants in healthcare elderly in China.Methods A cross sectional survey was carried out from August 1st,2008 to June 30th,2009,that including 736 60-year-olds from a Health Management Research Institute,Chinese PLA General Hospital.Data was double entried in computer and organized by EpiData 3.0.Non conditional logistic regression model was used for odd ratio (OR)and 95%CI,with the use of SPSS 13.0.Results The three leading foodstuff on intolerance were crab,egg and shrimp,with the prevalence rates as 35.9%,28.8% and 15.1% respectively.Results from the multiple regression analysis showed that the crab intolerance was associated with Helicobacter pylori infections (P<0.05).The OR (95%CI) of Helicobacterpylori infections (DOB≥4) was 1.544 (1.139-2.091).Conclusion The three leading intolerance foods were egg,crab and shrimp.Crab intolerance was associated with Helicobacter pylori infections.To reduce the risk of crab intolerance,it was necessary to control the infection caused by Helicobacter pylori.