AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor （ErbB）， namely ErbB1， ErbB2， ErbB3， and ErbB4， in the spinal dorsal horn of inflammatory pain model rats， and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）". MethodsThe study was divided into five parts. In experiment 1， 14 Sprague Dawley （SD） rats were randomly divided into control and inflammatory pain group （7 rats each group） to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2， 30 rats were randomly divided into control group 1， inflammatory pain group 1， and low-， medium-， and high-concentration TX1-85-1 groups， with 6 rats in each group， to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3， 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group， with 6 rats in each group， to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4， 44 rats were randomly divided into control group 2， inflammatory pain group 2， electroacupuncture group， and sham electroacupuncture group， with 11 rats in each group， to observe the effect of electroacupuncture. In experiment 5， 40 rats were randomly divided into control group 3， inflammatory pain group 3， electroacupuncture group 1， and electroacupuncture + NRG1 group， with 10 rats in each group， to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-， medium-， and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA （shRNA） into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli （ST 36）" and "Kunlun （BL 60）" from day 1 to day 7 after modeling， with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 （NRG1） after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1， 3， 5， and 7 after modeling to evaluate behavior， and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group， rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats， and increased expression of phosphorylated ErbB3 （p-ErbB3） protein in the spinal dorsal horn on days 1， 3， 5， and 7 after modeling （P＜0.01）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 1， the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 1， 3， 5， and 7 after modeling， compared with the control virus group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased （P＜0.05）. On day 5 and day 7 after modeling， compared with the inflammatory pain group 2 and the sham electroacupuncture group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased， and the expression of p-ErbB3 protein decreased （P＜0.05）. On day 5 and day 7 after modeling， compared with the electroacupuncture + NRG1 group， the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased （P＜0.05）. ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain， and electroacupuncture at "Zusanli （ST 36）" and "Kunlun （BL 60）" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease （CHD） with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group （6 pigs） and a high-fat diet group （24 pigs）. After 2 weeks of high-fat diet feeding， the high-fat diet group was randomly subdivided into a model group， an atorvastatin group （1 mg·kg^-1）， and Danlou tablet groups （0.6 g·kg^-1 and 0.3 g·kg^-1）. All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet， underwent only coronary angiography， and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later， they underwent a coronary angiography injury procedure. After the procedure， drugs were mixed into the feed every morning for 8 consecutive weeks， with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins， and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group， the model group showed a significant increase in total cholesterol （TC）， triglyceride （TG）， high-density lipoprotein cholesterol （HDL-C）， and low-density lipoprotein cholesterol （LDL-C） of minipigs' serum （P<0.01）， a significant shortening in prothrombin time of （PT） （P<0.01）， a coagulation function index， and an increase in whole blood viscosity （P<0.01） and platelet aggregation rate （P<0.01）. Moreover， the platelet morphology was altered， and the contents of endothelin-1 （ET-1） and nitric oxide （NO） were significantly increased （P<0.01）. Hemodynamic parameters were obviously abnormal， including significantly decreased systolic blood pressure （SBP）， diastolic blood pressure （DBP）， mean arterial pressure （MAP）， left ventricular systolic pressure （LVSP）， and left ventricular maximal positive dp/dt （LV+dp/dt_max） （P<0.01）. Left ventricular maximal negative dp/dt （LV-dp/dt_max） was significantly increased （P<0.01）. Besides， there were myocardial cell hypertrophy， obvious edematous degeneration， massive interstitial inflammatory cell infiltration， high degree of fibrosis， and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg^-1 and 0.3 g·kg^-1 （P<0.05， P<0.01）， compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg^-1 （P<0.05）. In groups with all doses of Danlou tablet， maximum aggregation rate （MAR） and average aggregation rate （AAR） were significantly decreased （P<0.05， P<0.01）， and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg^-1， NO level in the serum was reduced （P<0.05）. In groups with all doses of Danlou tablet， DBP and MAP were significantly increased （P<0.05）. In the Danlou tablet group with 0.6 g·kg^-1， LVSP and LV+dp/dt_max were significantly increased （P<0.05， P<0.01）， and LV-dp/dt_max was significantly decreased （P<0.05）. In groups with all doses of Danlou tablet， edematous degeneration in myocardial tissue was milder， and coronary artery lesion degree was significantly alleviated. Compared with the normal control group， there were 94 differentially expressed proteins in the model group， including 81 up-regulated and 13 down-regulated proteins. Compared with the model group， the Danlou tablet group with 0.6 g·kg^-1 showed 174 differentially expressed proteins， including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation， aggregation， and adhesion effects through biological pathways such as regulation of actin cytoskeleton， platelet activation pathway， Fcγ receptor-mediated phagocytosis， as well as proteins such as growth factor receptor-bound protein 2 （GRB2）， Ras-related C3 botulinum toxin substrate 2 （RAC2）， RAC1， and heat shock protein 90 alpha family class A member 1 （HSP90AA1）. ConclusionDanlou tablet can effectively reduce platelet activation and aggregation， exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway， as well as proteins like GRB2， RAC2， RAC1， and HSP90AA1， thereby exerting a pharmacological effect in anti-platelet activation， aggregation， and adhesion.

Objective: To analyze the relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschool children in a Beijing kindergarten, so as to provide a reference for promoting the development of motor competence. Methods: From September 2018 to March 2021, preschoolers aged 4-5 years were selected using convenience sampling method from an urban kindergarten in Beijing. The Test of Gross Motor Development-Third Version(TGMD-3) was used to assess basic preschoolers s gross motor skills ( n =152). The Pictorial Scale of Perceived Movement Skill Competence(PMSC) was used to evaluate perceptual motor skills ( n =151). Accelerometers (Actigraph GT3X) were used to record physical activity levels ( n =52). Data were analyzed using one way analysis of variance (ANOVA) and Pearson correlation coefficients. Results: The mean scores for gross motor skills and perceptual motor abilities were (38.76±13.48) and (35.49±6.50), respectively. The moderate to vigorous physical activity(MVPA) level was(52.60±27.44) minutes per day. No statistically significant correlations were found between gross motor skills, perceptual motor abilities MVPA among boys, girls or the overall group ( r =-0.20 to 0.25, all P >0.05). However, Boys locomotor skills, overall children s locomotor skills, and boys gross motor skills were all positively correlated with MVPA( r =0.34-0.45, all P <0.05). Conclusion There is a correlation between locomotor skills and physical activity levels in 4 to 5-year-old children.

Background: s/Aims: Sarcomatoid hepatocellular carcinoma (HCC) is a rare histological subtype of HCC characterized by extremely poor prognosis; however, its molecular characterization has not been elucidated. Methods: In this study, we conducted an integrated multiomics study of whole-exome sequencing, RNA-seq, spatial transcriptome, and immunohistochemical analyses of 28 paired sarcomatoid tumor components and conventional HCC components from 10 patients with sarcomatoid HCC, in order to identify frequently altered genes, infer the tumor subclonal architectures, track the genomic evolution, and delineate the transcriptional characteristics of sarcomatoid HCCs. Results: Our results showed that the sarcomatoid HCCs had poor prognosis. The sarcomatoid tumor components and the conventional HCC components were derived from common ancestors, mostly accessing similar mutational processes. Clonal phylogenies demonstrated branched tumor evolution during sarcomatoid HCC development and progression. TP53 mutation commonly occurred at tumor initiation, whereas ARID2 mutation often occurred later. Transcriptome analyses revealed the epithelial–mesenchymal transition (EMT) and hypoxic phenotype in sarcomatoid tumor components, which were confirmed by immunohistochemical staining. Moreover, we identified ARID2 mutations in 70% (7/10) of patients with sarcomatoid HCC but only 1–5% of patients with non-sarcomatoid HCC. Biofunctional investigations revealed that inactivating mutation of ARID2 contributes to HCC growth and metastasis and induces EMT in a hypoxic microenvironment. Conclusions We offer a comprehensive description of the molecular basis for sarcomatoid HCC, and identify genomic alteration (ARID2 mutation) together with the tumor microenvironment (hypoxic microenvironment), that may contribute to the formation of the sarcomatoid tumor component through EMT, leading to sarcomatoid HCC development and progression.

Background/Aims: Metabolic dysfunction-associated steatohepatitis (MASH) is a significant risk factor for gallstone formation, but mechanisms underlying MASH-related gallstone formation remain unclear. Golgi membrane protein 1 (GOLM1) participates in hepatic cholesterol metabolism and is upregulated in MASH. Here, we aimed to explore the role of GOLM1 in MASH-related gallstone formation. Methods: The UK Biobank cohort was used for etiological analysis. GOLM1 knockout (GOLM1-/-) and wild-type (WT) mice were fed with a high-fat diet (HFD). Livers were excised for histology and immunohistochemistry analysis. Gallbladders were collected to calculate incidence of cholesterol gallstones (CGSs). Biles were collected for biliary lipid analysis. HepG2 cells were used to explore underlying mechanisms. Human liver samples were used for clinical validation. Results: MASH patients had a greater risk of cholelithiasis. All HFD-fed mice developed MASH, and the incidence of gallstones was 16.7% and 75.0% in GOLM1-/- and WT mice, respectively. GOLM1-/- decreased biliary cholesterol concentration and output. In vivo and in vitro assays confirmed that GOLM1 facilitated cholesterol efflux through upregulating ATP binding cassette transporter subfamily G member 5 (ABCG5). Mechanistically, GOLM1 translocated into nucleus to promote osteopontin (OPN) transcription, thus stimulating ABCG5-mediated cholesterol efflux. Moreover, GOLM1 was upregulated by interleukin-1β (IL-1β) in a dose-dependent manner. Finally, we confirmed that IL-1β, GOLM1, OPN, and ABCG5 were enhanced in livers of MASH patients with CGSs. Conclusions In MASH livers, upregulation of GOLM1 by IL-1β increases ABCG5-mediated cholesterol efflux in an OPN-dependent manner, promoting CGS formation. GOLM1 has the potential to be a molecular hub interconnecting MASH and CGSs.

Background: A simple superoposterior approach to thoracic transforaminal epidural injections (TFEIs) under ultrasonographic guidance was proposed to reduce zoster-associated pain (ZAP) involving multiple thoracic nerves and the likelihood of transitioning to postherpetic neuralgia (PHN). Methods: Patients were prospectively enrolled. Primary endpoints were the burden of illness (BOI) scores and epidural contrast spread. Secondary endpoints included number of needle insertion attempts, sensory blockade, hemodynamic changes, procedure time, radiation dose, adverse events, rescue analgesics, PHN incidence and EuroQoL 5-Dimension scores. Results: Thirty-five injections were performed in 27 patients. Median levels of cephalad-caudad epidural contrast spread were 3, 4, and 5 ml following injections of 2, 3, and 4 ml. Dorsal epidural spread was observed at levels 3, 4, and 5, whereas concurrent ventral spread was observed at levels 2, 3, and 4. BOI scores at 30–180 days significantly decreased (mean difference: −25.3, 95% CI [−57.4 to 6.6], P = 0.005), accounting for reduced rescue analgesic requirements and PHN occurrence and improved EuroQoL 5-Dimension scores. Median sensory blockade at 5 min post-procedure was at level 2, 3, and 4 after 2, 3, and 4 ml of therapeutic injectate. No significant hemodynamic changes were noted at 15 min post-injection. No serious adverse events were observed. Conclusions Spread of thoracic epidural contrast to all involved nerves was confirmed using this novel technique. Simplified needle placement reduced the technical difficulty and risk of complications. It might be a promising alternative approach for ZAP.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.