AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

Based on copper death, this study investigates the effect and mechanism of Shenmai Injection on isoproterenol(ISO)-induced myocardial fibrosis(MF) in rats. SPF-grade male SD rats were randomly divided into a normal group, model group, captopril(5 mg·kg~(-1)) positive control group, and Shenmai Injection low(6 mL·kg~(-1)), medium(9 mL·kg~(-1)), and high(12 mL·kg~(-1)) dose groups. Except for the normal group, the rats in the other groups were subcutaneously injected with ISO(5 mg·kg~(-1)) once a day for 10 consecutive days to establish an MF model. Starting from the second day after successful modeling, intraperitoneal injections of the respective treatments were administered for 28 consecutive days. Hematoxylin-eosin(HE) and Masson staining were used to observe pathological changes and fibrosis levels in the myocardial tissue. Colorimetry was employed to detect serum Cu~(2+) concentration in rats. The levels of inflammatory cytokines interleukin-6(IL-6), interleukin-1β(IL-1β), interleukin-18(IL-18), tumor necrosis factor-α(TNF-α), as well as mitochondrial energy metabolites adenosine triphosphate(ATP), adenosine diphosphate(ADP), and adenosine monophosphate(AMP) in serum were measured using enzyme-linked immunosorbent assay(ELISA). Western blot was performed to detect the expression of collagen Ⅰ(Col-Ⅰ), collagen Ⅲ(Col-Ⅲ), and copper death-related proteins dihydrolipoamide acetyltransferase(DLAT), ferredoxin 1(FDX1), lipoic acid synthetase(LIAS), and heat shock protein 70(HSP70) in myocardial tissue. Immunofluorescence was used to detect the expression of DLAT, FDX1, and HSP70, while immunohistochemistry was conducted to examine the expressions of DLAT, FDX1, LIAS, and HSP70. The results showed that, compared to the model group, the myocardial structure disorder and collagen fiber deposition in the drug treatment groups were significantly improved, the cardiac index level was reduced, serum Cu~(2+), IL-6, IL-1β, IL-18, TNF-α, ADP, and AMP levels were significantly decreased, ATP levels were significantly increased, and the expressions of Col-Ⅰ, Col-Ⅲ, and HSP70 proteins in myocardial tissue were significantly reduced, while the expressions of DLAT, FDX1, and LIAS proteins were significantly elevated. In conclusion, Shenmai Injection effectively alleviates myocardial structure disorder and interstitial collagen fiber deposition in ISO-induced MF rats, promotes copper excretion, and reduces copper death in the ISO-induced rat MF model.
Animals ; Male ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Myocardium/metabolism* ; Drug Combinations ; Fibrosis/metabolism* ; Copper/blood* ; Cardiomyopathies/genetics* ; Humans

In most types of erectile dysfunction, particularly in advanced stages, typical pathological features observed are reduced parenchymal cells coupled with increased tissue fibrosis. However, the current treatment methods have shown limited success in reversing these pathologic changes. Recent research has revealed that changes in autophagy levels, along with alterations in apoptosis and fibrosis-related proteins, are linked to the progression of erectile dysfunction, suggesting a significant association. Autophagy, known to significantly affect cell fate and tissue fibrosis, is currently being explored as a potential treatment modality for erectile dysfunction. However, these present studies are still in their nascent stage, and there are limited experimental data available. This review analyzes erectile dysfunction from a pathological perspective. It provides an in-depth overview of how autophagy is involved in the apoptotic processes of smooth muscle and endothelial cells and its role in the fibrotic processes occurring in the cavernosum. This study aimed to develop a theoretical framework for the potential effectiveness of autophagy in preventing and treating erectile dysfunction, thus encouraging further investigation among researchers in this area.
Male ; Humans ; Autophagy/physiology* ; Apoptosis/physiology* ; Erectile Dysfunction/physiopathology* ; Fibrosis ; Penis/pathology* ; Animals ; Endothelial Cells/pathology* ; Myocytes, Smooth Muscle/pathology*

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Sigma-1 receptor (σ ₁R) has become a focus point of drug discovery for central nervous system (CNS) diseases. A series of novel 1-phenylethan-1-one O-(2-aminoethyl) oxime derivatives were synthesized. In vitro biological evaluation led to the identification of 1a, 14a, 15d and 16d as the most high-affinity (K _i < 4 nmol/L) and selective σ ₁R agonists. Among these, 15d, the most metabolically stable derivative exhibited high selectivity for σ ₁R in relation to σ ₂R and 52 other human targets. In addition to low CYP450 inhibition and induction, 15d also exhibited high brain permeability and excellent oral bioavailability. Importantly, 15d demonstrated effective antipsychotic potency, particularly for alleviating negative symptoms and improving cognitive impairment in experimental animal models, both of which are major challenges for schizophrenia treatment. Moreover, 15d produced no significant extrapyramidal symptoms, exhibiting superior pharmacological profiles in relation to current antipsychotic drugs. Mechanistically, 15d inhibited GSK3β and enhanced prefrontal BDNF expression and excitatory synaptic transmission in pyramidal neurons. Collectively, these in vivo proof-of-concept findings provide substantial experimental evidence to demonstrate that modulating σ ₁R represents a potential new therapeutic approach for schizophrenia. The novel chemical entity along with its favorable drug-like and pharmacological profile of 15d renders it a promising candidate for treating schizophrenia.

OBJECTIVE: We aimed to investigate the patterns of fasting blood glucose (FBG) trajectories and analyze the relationship between various occupational hazard factors and FBG trajectories in male steelworkers. METHODS: The study cohort included 3,728 workers who met the selection criteria for the Tanggang Occupational Cohort (TGOC) between 2017 and 2022. A group-based trajectory model was used to identify the FBG trajectories. Environmental risk scores (ERS) were constructed using regression coefficients from the occupational hazard model as weights. Univariate and multivariate logistic regression analyses were performed to explore the effects of occupational hazard factors using the ERS on FBG trajectories. RESULTS: FBG trajectories were categorized into three groups. An association was observed between high temperature, noise exposure, and FBG trajectory ( P < 0.05). Using the first quartile group of ERS1 as a reference, the fourth quartile group of ERS1 had an increased risk of medium and high FBG by 1.90 and 2.21 times, respectively (odds ratio [ OR] = 1.90, 95% confidence interval [ CI]: 1.17-3.10; OR = 2.21, 95% CI: 1.09-4.45). CONCLUSION An association was observed between occupational hazards based on ERS and FBG trajectories. The risk of FBG trajectory levels increase with an increase in ERS.
Humans ; Male ; Adult ; Blood Glucose/analysis* ; China ; Prospective Studies ; Occupational Exposure/adverse effects* ; Risk Factors ; Middle Aged ; Steel ; Fasting/blood* ; Metal Workers ; East Asian People

AIM To investigate the effects of Zhuangyao Shuanglu Tongnao Formula on neuronal apoptosis in rats with cerebral ischemia-reperfusion injury based on the study of oxidative stress and inflammatory response.METHODS The rats were randomly divided into the sham operation group,the model group,the edaravone group(3.0 mg/kg),the low,medium and high dose groups(9.0,18.0,36.0 g/kg)of Zhuangyao Shuanglu Tongnao Formula,with 18 rats in each group.The middle cerebral artery occlusion/reperfusion was conducted by thread embolism method to simulate cerebral ischemia reperfusion injury in rats followed by 6 days corresponding drugs administration.Subsequently,the rats had their neurological function deficit scored by Zeal Longa scoring method;their sizes of cerebral infarction areas measured by TTC staining;their pathological damage and apoptosis of neurons in hippocampal CA1 area of ischemic penumbra of the brain tissue detected by HE staining and TUNEL staining;their SOD activity and levels of GSH,MDA,IL-6,IL-1β,TNF-α in brain tissue detected by kits;and their protein expressions of Bax,Bcl-2,caspase-3,cleaved-capase-3,TLR4,NF-κB p65,Nrf2,HO-1 in rat brain tissue determined by Western blot.RESULTS Compared with the model group,the groups intervened with edaravone,medium and high dose of Zhuangyao Shuanglu Tongnao Formula displayed improvements in the scores of nerve function defects,the rate of cerebral infarction,the rate of neuronal apoptosis,the levels of IL-6,IL-1β,TNF-α and MDA in the ischemic penumbra of brain tissues,the protein expressions of Bax and TLR4,the ratio of cleaved-capase-3/caspase-3 and p-NF-κB p65/NF-κB p65(P＜0.05),the levels of GSH,the activity of SOD and the protein expressions of Bcl-2,Nrf2 and HO-1(P＜0.05).CONCLUSION Being an inhibitor of oxidative stress and inflammatory response,Zhuangyao Shuanglu Tongnao Formula can alleviate brain injury in rats with cerebral ischemia reperfusion injury through the inhibition of neuronal apoptosis and improvement of neural function mediated by the inhibition of TLR4/NF-κB signal pathway and activation of Nrf2/HO-1 signal pathway.

Zi goose is a small local variety with high fecundity,good meat quality,roughage resist-ance,strong adaptability and excellent down quality.It is an excellent female parent for cross breeding among varieties.With the rapid development of goose industry,the variety of Zi goose has not been well protected,the variety is hybrid and degraded seriously,and the number of pure Zi goose is decreasing day by day.This paper reviewed the research progress on the breeding distribu-tion and preservation status of Zi goose and the variety characteristics of Zi goose,in order to pro-vide reference for the research,protection and utilization of germplasm resources of Zi goose and the stable development of goose industry.

BACKGROUND:It was found that the ligands and receptors of Notch are both cell membrane surface proteins,which are important proteins to mediate intercellular communication,and the Notch signaling pathway plays a crucial regulatory role in the proliferation and differentiation of mesenchymal stem cells. OBJECTIVE:To review the regulatory mechanism of the Notch signaling pathway on the proliferation and differentiation of mesenchymal stem cells,summarize and clarify the research advance in how the Notch signaling pathway regulates the proliferation and differentiation of mesenchymal stem cells,and provide theoretical support for the future use of stem cells to treat various related diseases. METHODS:By using the computer,the first author searched the relevant studies involving Notch signaling pathway regulation of mesenchymal stem cell proliferation and differentiation on CNKI,Wanfang,VIP,PubMed,Web of Science,and Nature databases with Chinese search terms"mesenchymal stem cells,Notch,Notch signaling pathway,proliferation,differentiation"and the English search terms"mesenchymal stem cells,MSC,Notch,Notch signaling pathway,proliferation,differentiation".Part of the literature was searched in combination with the literature tracing method.Finally,87 articles were included in the review analysis. RESULTS AND CONCLUSION:(1)Notch signaling pathway is a conserved signaling pathway in multicellular organisms,which plays an important role in regulating cell differentiation,proliferation,apoptosis,and the cell cycle by mediating communication between neighboring cells through receptor-ligand binding.(2)Mesenchymal stem cells are a class of adult stem cells with self-proliferative and multi-directional differentiation potential,which can be regulated by external signaling pathways to affect their proliferation and differentiation.Notch signaling pathway,as one of them,when Notch ligands are activated,the Notch proteins will undergo two protein hydrolysis cleavages to release Notch intracellular structural domain NICD,which then enters the nucleus and thus promotes the transcription of target genes to regulate the proliferation and differentiation of mesenchymal stem cells from different sources,such as bone marrow,adipose,and umbilical cord.However,the specific mechanisms that regulate the proliferation and differentiation of mesenchymal stem cells from different tissue sources of the same species are different.(3)The Notch signaling pathway can regulate the differentiation of mesenchymal stem cells into different target cells,but due to different target cells,the expression levels of receptors or ligands in the Notch signaling pathway vary.(4)Clinical targeting of the Notch signaling pathway to promote mesenchymal stem cells for the treatment of various refractory diseases,such as aplastic anemia,severe joint injuries,ischemic strokes,and myocardial infarctions,has a promising application.(5)By exploring the Notch signaling pathway via regulating the expression levels of its receptors and ligands in bone marrow mesenchymal stem cells from rat,mouse,and human,it can be found that the Notch signaling pathway expression levels in the proliferation and differentiation of mesenchymal stem cells from different species origins are also different.(6)The role of mesenchymal stem cells in tissue engineering has been gradually highlighted due to their advantages of safety,low immune rejection,and wide therapeutic prospects.The Notch signaling pathway regulates the proliferation and differentiation of mesenchymal stem cells with a wide range of influencing factors,and subsequent studies should further optimize the influencing factor variables and explore the standardized studies of regulating the proliferation and differentiation of mesenchymal stem cells.