Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the efficacy of molecular targeted agents in children with progressive pediatric low-grade gliomas (pLGG). METHODS: A retrospective analysis was conducted on pLGG patients treated with oral targeted therapies at the Department of Pediatrics, Beijing Shijitan Hospital, Capital Medical University, from July 2021. Treatment responses and safety profiles were assessed. RESULTS: Among the 20 enrolled patients, the trametinib group (n=12, including 11 cases with BRAF fusions and 1 case with BRAF V600E mutation) demonstrated 4 partial responses (33%) and 2 minor responses (17%), with a median time to response of 3.0 months. In the vemurafenib group (n=6, all with BRAF V600E mutation), 5 patients achieved partial responses (83%), showing a median time to response of 1.0 month. Comparative analysis revealed no statistically significant difference in progression-free survival rates between the two treatment groups (P>0.05). The median duration of clinical benefit (defined as partial response + minor response + stable disease) was 11.0 months for vemurafenib and 18.0 months for trametinib. Two additional cases, one with ATM mutation treated with olaparib for 24 months and one with NF1 mutation receiving everolimus for 21 months, discontinued treatment due to sustained disease stability. No severe adverse events were observed in any treatment group. CONCLUSIONS Molecular targeted therapy demonstrates clinical efficacy with favorable tolerability in pLGG. Vemurafenib achieves high response rates and induces early tumor shrinkage in patients with BRAF V600E mutations, supporting its utility as a first-line therapy.
Humans ; Glioma/genetics* ; Male ; Female ; Child ; Child, Preschool ; Retrospective Studies ; Brain Neoplasms/genetics* ; Molecular Targeted Therapy/adverse effects* ; Adolescent ; Infant ; Proto-Oncogene Proteins B-raf/genetics* ; Pyrimidinones/therapeutic use* ; Mutation

BACKGROUND: It remains unclear whether sleep duration and physical activity (PA) trajectories in middle-aged and older adults are associated with different risks of cardiovascular diseases (CVDs). This study aimed to explore the trajectories of total sleep duration and PA among middle-aged and older Chinese adults and their impact on CVD risk. METHODS: This study was based on the China Health and Retirement Longitudinal Study. 12009 adults aged 45 years and older from five waves were included. CVD events were measured by self-reports of heart disease and stroke. We first used group-based trajectory modeling to identify total sleep duration and PA trajectories from 2011 to 2020, and then employed logistic regression models to analyze their risk for CVD. RESULTS: We identified three sleep duration and PA trajectories. The risk of heart disease increased by 33% (OR = 1.31, 95% CI: 1.12-1.53) for the short sleep duration trajectory (vs. moderate sleep duration trajectory), by 40% (OR = 1.40, 95% CI: 1.06-1.84) for the high decreasing PA trajectory, and by 20% (OR = 1.20, 95% CI: 1.01-1.42) for the low stable PA trajectory (vs. high stable PA trajectory), respectively. Similar results for stroke and CVD as the outcomes were also observed, but the higher risk of stroke in the high decreasing PA trajectory group was not statistically significant. The joint effects of sleep and PA showed lower risks of heart disease and stroke in trajectories with moderate or long sleep duration and high stable PA compared with short sleep duration and a low stable PA trajectory. CONCLUSIONS Short total sleep duration, high decreasing PA, and low stable PA trajectories could increase the risk of CVDs among middle-aged and older adults. Long-term moderate to long total sleep durations and high stable PA trajectories might be optimal for preventing CVDs.

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

T-cell acute lymphoblastic leukemia (T-ALL) is a highly aggressive hematologic malignancy with a poor prognosis, despite advancements in treatment. Many patients struggle with relapse or refractory disease. Investigating the role of the super-enhancer (SE) regulated gene ubiquitin-specific protease 20 (USP20) in T-ALL could enhance targeted therapies and improve clinical outcomes. Analysis of histone H3 lysine 27 acetylation (H3K27ac) chromatin immunoprecipitation sequencing (ChIP-seq) data from six T-ALL cell lines and seven pediatric samples identified USP20 as an SE-regulated driver gene. Utilizing the Cancer Cell Line Encyclopedia (CCLE) and BloodSpot databases, it was found that USP20 is specifically highly expressed in T-ALL. Knocking down USP20 with short hairpin RNA (shRNA) increased apoptosis and inhibited proliferation in T-ALL cells. In vivo studies showed that USP20 knockdown reduced tumor growth and improved survival. The USP20 inhibitor GSK2643943A demonstrated similar anti-tumor effects. Mass spectrometry, RNA-Seq, and immunoprecipitation revealed that USP20 interacted with hypoxia-inducible factor 1 subunit alpha (HIF1A) and stabilized it by deubiquitination. Cleavage under targets and tagmentation (CUT&Tag) results indicated that USP20 co-localized with HIF1A, jointly modulating target genes in T-ALL. This study identifies USP20 as a therapeutic target in T-ALL and suggests GSK2643943A as a potential treatment strategy.