1.Role of hippocampal histone acetylation in isoflurane-induced amnestic effect in mice
Qiuju QING ; Tao ZHONG ; Yanfeng ZHANG ; Xinyao LIU ; Jianqin YAN
Chinese Journal of Anesthesiology 2013;33(11):1346-1348
Objective To evaluate the role of hippocampal histone acetylation in isoflurane-induced amnestic effect in mice.Methods Fifty-four male C57BL/6J mice,aged 8 weeks,weighing 18-22 g,were randomly divided into 3 groups (n =18 each) using a random number table:control group (group C),isoflurane group (group ISO) and histone deacetylase inhibitor sodium butyrate group (group SB).Group C inhaled 35% oxygen for 30 ain,and ISO and SB groups inhaled the mixture of 35 % oxygen and 0.4% isoflurane for 30 min,and then the animals underwent contextual fear conditioning training.After the end of training,normal saline 6 ml/kg was intraperitoneally injected in C and ISO groups,while in group SB,sodium butyrate 1.2 g/kg was intraperitoneally injected.One hour after the end of training,3 mice were sacrificed randomly in each group and their hippocampi were immediately removed for determination of the expression of acetylated histone-H3 (Ac-H3) and Ac-H4 by Western blot.Twenty-four hours after the end of training,contextual fear conditioning test and open field test were conducted.The freezing time,total distance and time of staying at the central zone were recorded.Results Compared with group C,Ac-H3 and Ac-H4 expression was significantly down-regulated,and the percentage of freezing time during testing was decreased in group ISO (P < 0.05).Compared with group ISO,Ac-H3 and Ac-H4 expression was significantly up-regulated,and the percentage of freezing time during testing was increased in group SB (P < 0.05).There was no significant difference in the percentage of freezing time during training,total distance and time of staying in the central zone among the 3 groups (P > 0.05).Conclusion Hippocampal histone acetylation is involved in the regulation of isoflurane-induced amnestic effect in mice.
2.RFLPs ANALYSIS OF DIGOXIGENIN-LABELLED pAW101 PROBE AND ITS PRACTICAL USES
Chao LIU ; Chaoquan LUO ; Yinghao YANG ; Xinyao WU ; Jianyang LUO
Chinese Journal of Forensic Medicine 1987;0(03):-
A new method to revel RFLPs is presented. The human genomic DNAwas purified by saturatedNaCl solution and the pAW101 probe labelled with digoxigenin-dUTP. The relationships of RFLPsand genetic patterns of PGM1 (phosphoglucomutase),EsD (esterase D),GLO1 (glyoxalase)and ACP(acid phosphatase ) between the fillal generation and parental generation were detected in 15 families(among them 11 cases were aborted fetuses). The probability of paternity (w)was caculated accor-ding to Essen - Moller's formula, each w vlua was over 99. 73 %, reached the standard of incladingpaternity. An effective,rapid, and non-toxic RFLPs technique was established, which is easy to man-age in common lab oratories.
3.Apoptotic Effects and Its Mechanisms on Leukemic K562 Cells Caused by Interferon-alpha Combined with Cytarabine
Jiajun LIU ; Xinyao WU ; Xiangling PAN ; Guiqin CAI
Chinese Journal of Cancer Biotherapy 1995;0(03):-
Objective: To investigate the apoptotic effects and its mechanisms on K562 cells caused by Interferon-alpha (INF-?) and Cytarabine (Ara-C). Methods: The variation of both morphology and inhibitory rate of K562 cells was observed in culture medium with IFN-? and various concentrations of Ara-C at different time in vitro. The variation of telomerase activity and P53 protein expression were detected before and after apoptosis occurred. Results: INF-? and Ara-C used concurrently could cause apoptosis and inhibit the growth of K562 cells as well as decrease the telomerase activity and increase P53 protein expression significantly. All these processes showed both in time- and dose-dependent manner. Conclusions: INF-? and Ara-C used concurrently can inhibit the growth of K562 cells and induce apoptosis, inhibiting the telomerase activity and increasing the expression of P53 protein may be one of the most important mechanisms.
4.Mechanisms of orindonin induced apoptosis on NB_4 cells
Jiajun LIU ; Xinyao WU ; Xianglin PAN ; Guiqing CAI ;
Chinese Traditional Patent Medicine 1992;0(11):-
Objective: To explore the mechanism of orindonin induced apoptosis on NB4 (Human acute promylocytic leukeamia cell line) cells. Methods: The variation of both morphology and inhibitory rate of NB4 cells were observed in culture medium with various concentrations of orindonin at different time in vitro. The activity of Caspase3 was detected before and after apoptosis occurred. Results: orindonin could increase the activity of Caspase3, inhibit the growth and cause apoptosis on NB4 cells significantly. The variations were both in time and dose dependent manner. Conclusion: Orindonin can inhibit the growth of NB4 cells and induce apoptosis. Increasing the activity of Caspase3 may be one of the most important mechanism.
5.Risk factors of thyroid nodule in diabetic patients and the correlation with Traditional Chinese Medicine constitution
Huan HE ; Yanwen PENG ; Ying LIU ; Jing XUE ; Xiyan ZHAO ; Xinyao XU ; Mingdi LI
International Journal of Traditional Chinese Medicine 2021;43(4):329-334
Objective:To explore the risk factors of thyroid nodules in diabetic patients and its correlation with Traditional Chinese Medicine (TCM) constitution.Methods:A Total of 213 cases of diabetic patients in Guang’anmen Hospital and Tangshan Hospital from January 2019 to August 2020 were choosen to do the questionnaire, with containly symptom and constitution. The patients were divided into diabetes with thyroid nodules group and diabetes without thyroid nodules group according to whether thyroid nodules were combined. We compared the clinical data characteristics of 2 groups, and used multi-factor logistic regression model to analyze the risk factors of diabetic patients with thyroid nodules and their correlation with TCM constitutions. Results:Diabetes patients aged from 50-80 years old [ OR=2.949, 95% CI (1.266-6.714)], females [ OR=3.736, 95% CI (1.823-1.541)], diabetes duration≥15 years [ OR=1.558, 95% CI (1.623-1.585)], elevated HbA1c [ OR=5.862, 95% CI (1.418-23.629)], elevated VLDL [ OR=2.851, 95% CI (1.597-6.824)], frequent insomnia [ OR=1.970, 95% CI (1.315-3.395)], Qi stagnation [ OR=4.357, 95% CI (2.634-8.377)], blood stasis [ OR=4.420, 95% CI (1.874-15.258)] are more likely to suffer from thyroid nodules ( P<0.05). Conclusion:Diabetic patients aged from 50-80 years old, females, diabetes duration≥15 years, elevated HbA1c, family history of thyroid nodules, frequent insomnia, and mood swings are more likely to develop thyroid nodules; qi stagnation and blood stasis are dangerous constitutions for diabetic patients with thyroid nodules.
6.Polymorphism of Five X-STRs Loci with a New Pentaplex PCR
Qiuling LIU ; Dejian LV ; Hu ZHAO ; Xinguo LI ; Huling LU ; Hongyu SUN ; Yanfang LIANG ; Xinyao WU
Journal of Sun Yat-sen University(Medical Sciences) 2009;30(4):404-407
[Objective] To learn about the genetic diversity,we studied the five X-chromosomal STR (X-STR) loci in Guangdong Han Nationality Groups.[Methods] The five Loci (DXS6803,DXS981,DXS6809,DXS6789,and DXS7132) were amplified in a pentaplex PCR reaction.PCR products were analyzed using capillary electrophoresis and ABI prism 3100 Genetic Analyzer,with GeneMapper ID 3.1 Analysis Software.[Results] A total of 363 individuals (181 unrelated male and 182 unrelated female) from Guangdong Han population were tested,54 alleles were observed for these loci.Polymorphism information content is 0.6935 ~ 0.8177.Power of discrimination in females was 0.8976 ~ 0.9562.Mean exclusion chance for X-STR in standard trios with daughters was 0.7805 ~ 0.8467.[Conclusion] The five loci in the multiplex system provide high polymorphism information for forensic identification and paternity testing,particularly for difficult paternity deficiency cases.
7.Comparison of HBV persistent infection mice models by different serotypes of AAVs carrying HBV genomes.
Xinyao ZHU ; Qingzhang ZHOU ; Wenhong TIAN ; Chunguo LIU ; Xiaoyan DONG ; Xiaobing WU ; Changyuan YU
Chinese Journal of Biotechnology 2015;31(12):1764-1772
In recent years, Hepatitis B virus (HBV) persistent infection mouse model with recombinant adeno-associated virus 8 carrying 1.3 copies of HBV genome (rAAV8-1.3HBV) is concerned. We studied and compared the efficacy among HBV persistent infection mice models by other serotypes except AAV8. First, we prepared and purified five viruses: rAAV1-1.3HBV, rAAV2-1.3HBV, rAAV5-1.3HBV, rAAV8-1.3HBV and rAAV9-1.3HBV. Then we injected each virus into 3 C57BL/6J mice with the dose of lx 1011 vg (Viral genome, vg) per mouse. We detected HBsAg and HBeAg in sera by enzyme-linked immunosorbent assay (ELISA) at different time points post injection. We killed mice 8 weeks post injection and took blood and livers for assay. We detected copies of HBV DNA by real-time quantitative PCR in sera and livers. Meantime, we detected HBcAg in the livers of mice by immunohistochemistry and further performed pathology analysis of these livers. The five groups of mice, HBeAg and HBsAg expression sustained 8 weeks in serological detection and HBV DNA was both detected in sera and livers at the time of 8 weeks post injection. HBeAg, HBsAg, HBV DNA copies expression levels in descending order were AAV8>AAV9>AAV1>AAV5>AAV2. HBcAg expression was detected in livers as well. Varied degrees of liver damage were shown in five groups of mice. This study provides more alternative AAV vector species to establish a persistent infection with hepatitis B model.
Animals
;
Dependovirus
;
classification
;
Disease Models, Animal
;
Enzyme-Linked Immunosorbent Assay
;
Genetic Vectors
;
Genome, Viral
;
Hepatitis B
;
virology
;
Hepatitis B Core Antigens
;
metabolism
;
Hepatitis B Surface Antigens
;
blood
;
Hepatitis B e Antigens
;
blood
;
Hepatitis B virus
;
genetics
;
Mice
;
Mice, Inbred C57BL
;
Serogroup
;
Virus Replication
8.Review on screen time among children and adolescents and impact on mental health
CAO Hui, LIAN Xinyao, CHEN Yuanyuan, SU Mintao, XU Qingsong, LIN Shujian, LIU Jufen
Chinese Journal of School Health 2023;44(3):462-465
Abstract
The popularization of the use of electronic has become a global trend, and children are exposed to devices at younger ages. A large proportion of children and adolescents spend on screen time more than 2 h which is recommended in most guidelines. The paper reviews possible effects of screen time on physical and mental health, as well as mental disorders in children and adolescents. It is found that excessive screen time showed negative impacts on mental health, including depression, anxiety, mood disorder, social adaptational problems, behavioral disorders, self injurious behaviors, and health risk behaviors. Much attention has been paid on the association between excessive screen time and mental health of children and adolescents, while possible mechanisms and influencing factors are lacking. Effective intervention studies are needed to provide a basis for child and adolescent health promotion.
9.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
10.Study on the mutation of human short tandem repeats at three loci.
Lei YU ; Jianjin LI ; Xinyao WU ; Lumei CAO ; Qiuling LIU ; Yanhong ZENG ; Jinghua OU
Chinese Journal of Medical Genetics 2002;19(4):308-312
OBJECTIVETo understand the mutational patterns and mechanism of short tandem repeats(STRs).
METHODSThe DNA samples of 19 parent-child pairs with mutations in three loci (FGA, D12S391, and D11S554) were genotyped by silver staining on STR. Alleles to be sequenced were excised from gels, reamplified by PCR, and purified. Sequencing was performed by use of cycle sequencing.
RESULTSThere were 18 out of 19 pedigrees in which the 'new' alleles gained or lost a single repeat (8 gains, 7 losses, and 3 being indistinguishable). Only one pedigree lost two repeats. In the 19 pedigrees, there were 13 pedigrees whose 'new' alleles came from fathers, 3 from mothers, 3 from either father or mother. The ratio was 4 1 between fathers and mothers. The mutation of three STR loci occurred in the long, uninterrupted tetranucleotide repeat regions ('CTTT' in FGA, 'AGAT' in D12S391, and 'AAAG' in D11S554).
CONCLUSIONSingle- step mutations accounted for 95% of STR mutation events in these three loci: FGA, D12S391, and D11S554. The rest were double step mutations. There was no insertion or deletion of an incomplete repeat in any of the pedigrees. The mutation was mainly caused by fathers. The long, uninterrupted tetranucleotide repeats in these three loci might be susceptible to mutation.
Alleles ; Base Sequence ; DNA ; chemistry ; genetics ; DNA Mutational Analysis ; Female ; Gene Frequency ; Genotype ; Humans ; Male ; Microsatellite Repeats ; genetics ; Mutation ; Nuclear Family ; Tandem Repeat Sequences ; genetics