1.Depressive symptoms and associated factors among middle school and college students from 2021 to 2023 in Hunan Province
Chinese Journal of School Health 2025;46(1):96-101
Objective:
To investigate the current status and trends of depressive symptoms among middle school and college students in Hunan Province, and to explore the primary related factors of depressive symptoms, so as to provide a scientific basis for strengthening mental health among students.
Methods:
A total of 279 382 students in Hunan Province were selected through a stratified cluster random sampling method from 2021 to 2023. National Survey Questionnaire on Common Diseases and Health Influencing Factors among Students was adopted for the survey, and the Center for Epidemiological Studies Depression Scale was used to assess their depressive symptoms. The χ 2 test and trend χ 2 test were used to analyze depressive symptoms prevalence and trends, and multivariable Logistic regression was used to analyze the related factors of depressive symptoms.
Results:
The prevalence of depressive symptoms among students in Hunan Province from 2021 to 2023 were 19.66%, 20.17% and 21.47%, respectively, showing an upward trend ( χ 2 trend =9.07, P <0.01). In addition, the results of the multivariable Logistic regression analysis showed that students with healthy diet ( OR=0.43, 95%CI =0.40-0.45), adequate sleep ( OR=0.88, 95%CI =0.86-0.90), and acceptable screen time ( OR=0.61, 95%CI =0.60-0.62) had lower risks in depressive symptoms detection, while students with smoking ( OR= 1.95, 95%CI =1.88-2.02), secondhand smoke exposure ( OR=1.33, 95%CI =1.30-1.36) and Internet addiction ( OR= 4.19 , 95%CI =4.05-4.34) had higher risks in depressive symptoms detection, with differences in the degree of association among different genders, educational stages and urban rural groups ( OR=0.40-6.04, Z =-12.69-11.98) ( P <0.05).
Conclusions
There is an increasing trend of depressive symptoms among middle school and college students in Hunan Province from 2021 to 2023.Targeted depression prevention measures should be taken for students with different demographic characteristics to promote their mental health.
2.Development of DUS Test Guidelines for New Pinellia ternata
Xinyao LI ; Mingxing WANG ; Bingbing LIAO ; Changjie CHEN ; Xiufu WAN ; Lanping GUO ; Yuhuan MIAO ; Dahui LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(10):225-233
Pinellia ternata, belonging to the Pinellia genus within the Araceae family, is a medicinal plant due to its tubers. There are severe issues with unclear germplasm and mixed varieties in its cultivation, necessitating urgent new variety protection efforts. The distinctness, uniformity, and stability (DUS) testing of the plant variety is the basis for protecting new plant varieties, and the DUS test guidelines are the technical basis for DUS testing. To develop the DUS test guidelines for P. ternata, agronomic traits of 229 germplasm of P. ternata were observed and measured during its two growth stages over the years, and each character was graded and described. A total of 38 traits were selected as the test traits of the DUS test guideline for P. ternata. There were three plant traits, 19 leaf traits, six flower traits, two fruit traits, two tuber traits, five bulbil traits, and one ploidy trait. These traits could be divided into 22 quality characters, 12 quantitative characters, and four pseudo-quantitative characters, as well as seven groups, including plants, leaves, flowers, fruit, tubers, bulbils, and ploidy. By searching for standard traits, 10 standard varieties were ultimately determined. Preparing these guidelines will have great significance for reviewing and protecting P. ternata varieties, safeguarding breeders' rights, and promoting the development of the P. ternata industry.
3.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
4.The application value of SWE in early hepatic fibrosis and renal fibrosis in MAFLD
Mengmeng QIAN ; Xiaochen GUO ; Pengfei WANG ; Xiu CHEN ; Xinyao WU ; Chunpeng ZOU ; Maosheng XU
China Modern Doctor 2024;62(33):23-27
Objective To explore the value of shear wave elastography(SWE)in the early assessment of hepatic and renal fibrosis in patients with metabolic associated fatty liver disease(MAFLD).Methods A total of 52 MAFLD patients admitted to the Second Affiliated Hospital of Wenzhou Medical University from July 2023 to May 2024 were selected as MAFLD group,and 40 non-MAFLD patients treated during the same period were served as control group.General information,laboratory data and ultrasound data were collected and compared between two groups.The differences as well as the correlation of the indicators between two groups were compared.The value of SWE in hepatic fibrosis and renal fibrosis in MAFLD patients was assessed.Results Liver function indicators,uric acid and aspartate aminotransferase-to-platelet ratio index(APRI)in MAFLD group were higher than those in control group(P<0.01);There were no statistically significant differences between two groups in fibrosis 4 index,estimated glomerular filtration rate,serum creatinine and blood urea nitrogen(P>0.05).The brightness of the liver,liver-kidney ratio,and liver elasticity value were higher in MAFLD group than those in control group(P<0.05);There was no significant difference in the elasticity value of the right renal cortex between two groups(P>0.05).Liver elasticity values was positively correlated with alanine aminotransferase(ALT);The liver-kidney ratio was positively correlated with body mass index(BMI),ALT,aspartate aminotransferase,alkaline phosphatase,y-glutamyl transferase and APRI.No significant correlation was found between the right renal cortex elasticity and BMI,estimated glomerular filtration rate,serum creatinine,blood urea nitrogen,or serum uric acid.Conclusion SWE helps in early identification of liver hardness in the MAFLD patients.But the application of SWE in early renal fibrosis in the MAFLD patients needs further evaluation.
5.Acute Myocardial Infarction Caused by Multiple Coronary Thrombosis:a Case Report
Lu CHEN ; Xinyao LIU ; Xing GE ; Bo CHEN ; Hairong YU ; Yafeng LU ; Caixia GUO
Chinese Circulation Journal 2024;39(9):913-916
Multiple thrombosis in the coronary arteries need to be characterized by a thorough determination of the source of the thrombus to distinguish them as thrombosis or coronary embolism.This case was a 38-year-old male patient with chest pain and an electrocardiogram showing acute inferior wall and right ventricular myocardial infarction.Emergency coronary angiography showed thrombosis in the proximal middle of the left anterior descending artery,the opening of the first diagonal artery,and the middle of the right coronary artery,but no obvious stenosis was seen.Postoperative electrocardiogram showed acute inferior wall,right ventricular and anterior wall myocardial infarction,and intensive antithrombotic treatment was applied,elective re-examination of coronary angiography and intraluminal imaging showed mixed plaques and suspicious intimal dissection,indicating the possibility of thrombosis secondary to unstable plaque and coronary dissection,and intensive drug treatment was given.After discharge,the patient was stable during the regular follow-up visits.
6.Study on TCM Syndrome Distribution and Prescription law of Inpatients with Sj?gren Syndrome-interstitial Lung Disease
Zilin GUO ; Xinyao ZHOU ; Xiaopo TANG
Chinese Journal of Information on Traditional Chinese Medicine 2024;31(10):164-171
Objective To analyze the TCM syndrome distribution and prescription law of inpatients with Sj?gren syndrome(SS)complicated by lung interstitial disease(ILD)using data mining methods.Methods The clinical data of SS-ILD inpatients who met the screening criteria from January 2010 to December 2021 at Guang'anmen Hospital,China Academy of Chinese Medical Sciences were collected.A statistical analysis of TCM syndrome type and basic information,clinical manifestation,tongue and pulse,laboratory examination,TCM prescription and so on was conducted.Results Totally 87 patients were included.There was no significant difference in gender,age,age of onset,disease course or smoking history across patients with distinct syndrome types.Patients with syndrome of combination of dryness and dampness had the highest probability of drinking history(P<0.05).There were substantial differences between syndrome types in the major complaints of xerostomia,joint swelling and pain,chest tightness,cough and joint swelling(P<0.05),but no significant differences in ILD special symptoms,tongue or pulse.The level of urea nitrogen was highest in patients with yin deficiency internal heat syndrome(P<0.05),with no significant difference in other laboratory data.There were 79 prescriptions and 217 kinds of Chinese materia medica in total.High-frequency medications were primarily used to strengthen the spleen and replenish qi,nourish yin and clear heat,nourish blood and promote blood circulation,mainly with neutral property,sweet taste,the main meridians were lung meridians,liver meridians and spleen meridians.The commonly used medicine matched the pathogenesis of deficiency and excess,and the core prescription was a modified combination of Bazhen Decoction and Yangyin Qingfei Decoction.Conclusion The TCM syndrome of SS-ILD is a mixture of deficiency and excess,with qi and yin deficiency as the foundation,turbid phlegm and blood stasis as the superficiality,lung,liver and spleen as the disease's locations.Clinical treatment of replenishing qi and nourishing yin,resolving phlegm,removing blood stasis,and dredging collaterals should be the general guidance.
7.Advances in research on mechanism of lactate dehydrogenase B in tumors
Yan BAI ; Xinyao GUO ; Qiliang QIN ; Fang YAN
Journal of China Pharmaceutical University 2023;54(2):172-179
Increased glycolysis is a major feature of metabolic reprogramming in cancer.Glycolysis provides not only energy for cancer cells but also necessary precursors for biosynthesis, which is important for promoting tumor growth.Cancer cells meet their own needs by regulating glycolytic enzymes, which play an active role in promoting cancer survival, metastasis, and invasion.Lactate dehydrogenase (LDH), as a key enzyme in glycolysis, consists of two subunits: lactate dehydrogenase A (LDHA) and lactate dehydrogenase B (LDHB).LDHA is known to play a key role in aerobic glycolysis and has been extensively studied, whereas less has been done on LDHB.However, at present, more and more reports have revealed the important effects of LDHB on the progression of various cancers.A large number of studies have shown that LDHB is abnormally expressed in a variety of cancers, which is related to the malignant progression of tumors.The article reviews the research progress of LDHB in recent ten years, including its regulatory mechanism in tumor, its relationship with cancer development and its role as a biomarker in clinical diagnosis of cancer, which provides some insight for further investigation of the mechanism of LDHB in cancer research.
8.Study on Optimal Conditions in Arbitrarily Primed PCR Human DNA Fingerprinting
Dayue TONG ; Ping XU ; Yubin GUO ; Fang LI ; Da LIN ; Jinghua OU ; Xinyao WU
Journal of Sun Yat-sen University(Medical Sciences) 2001;22(3):231-234
【Objective】To explore the optimal conditions in fingerprinting (APHDF).【Methods】The human DNA fingerprints were detected by APHDF.A pair of short primers was used for amplification.The experimental conditions including template,Mg2+,deoxyribonucleotides,and parameters of cycle,were optimized.【Results】The template DNA should be abstracted freshly and the concentration should be ranged from 50~550 mg/L.The best concentration of Mg2+was 5.0 mmol/L.The deoxyribonucleotides concentration was optimal at 0.2 mmol/L.The PCR cycling parameters were as follows :The denaturing temperatures,annealing temperatures and extension temperatures were 94 ℃ and 90 ℃ for 30 s,43 ℃ and 48 ℃ for 40 s or 50 s,and 72 ℃ for 1 min or 80 s,respectively.【Conclusion】The optimal conditions of the experiment are obtained,with good reproducibility and high specificity.Therefore,this method can be widely applied in practice.
9.THE HLA ANTIGENS AND ITS APPLICATION IN FORENSIC MEDICINE
Jingyuan GUO ; Xinyao WU ; Huiling LU
Chinese Journal of Forensic Medicine 1986;0(02):-
Since the HLA system is one of the most complex human genetic polym- orphisms,its application in forensic medicine included disputed paternity and criminal identification,have been fairly recognized. The present paper reported the results of our study about the HLA typing in human blood stain,serum and saliva,it was concluded that:(1).The existed strong anti-complementary activity in human blood stain when the amount of complement used in microlym-phocytotoxicity inhibition test(MLIT) was incresed to 10?l,it was found that the results of HLA-All,-B 5 typing in bloodstains were all correct,and the detectable period was at least 90 days; (2).The soluble HLA-A antigens in human serum could reliable detected with MLIT;(3).The soluble HLA-A antigens were also present in the human siliva.
10.THE PHENOTYPE DISTRIBUTION OF THE RED CELL GLYOXALASE I IN GUANGZHOU AREA AND PHENOTYPING OF GLYOXALASE I IN BLOODSTAINS
Jianjin LI ; Xinyao WU ; Jingyuan GUO
Chinese Journal of Forensic Medicine 1986;0(01):-
The phenotype distribution of human red cell glyoxalase I of a Han population in Guangzhou area was studied using mixed starch/agarose gel electrophoresis. The phenotype frequencies were: GLOI 1-1 2.57%; GLOI 2-1 29.17%; and GLOI 2-2 68.26%. The gene frequencies were: GLOI~1 0.1716; GLOI~2 0,8284. The phenotyping of GLOI was carried out satisfactorily in 35 bloodstains kept in room temperature for 20 days in 7 bloodstains stored in 4℃ for 105 days exposed in sunshine for 8 hours, as well as kept outdoor overnight, and in 10 putrefactive bloodstains kept in room temperature for 9 days.The GLOI were destroyed in 6 of 7 bloodstains washed by runing water for 2 hours.


Result Analysis
Print
Save
E-mail