The serum lipid and lipoprotien cholesterol levels of 1974 healthy subjects from newborn to 75 years of age and 51 patients with coronary heart disease (CHD) and cerebrovascular disease(CVD) were studied in Wuhan district. The serum lipid and lipoprotein cholseterol concentration varies with age. But no differences were found between male and female cord blood. In both sexes the serum T-C, LDL-C, HDL-C, T-C/HDL-C and LDL-C/ HDL-C ratio increased with the increasing of age. The serum HDL-C level has significant difference between male and female (P

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective: To investigate the incidence and pathogen distribution of ventilator-associated pneumonia (VAP) among preterm infants admitted to level Ⅲ neonatal intensive care units (NICU) in China. Method: A prospective study was conducted in 25 level Ⅲ NICU, enrolling all preterm infants <34 weeks gestational age admitted to the participating NICU within the first 7 days of life from May 2015 to April 2016. Chi-square test, t test and Mann-Whitney U test were used for statistical analysis. Result: A total of 7 918 patients were enrolled, within whom 4 623(58.4%) were males. The birth weight was (1 639±415) g and the gestational age was (31.4±2.0) weeks; 4 654(58.8%) infants required non-invasive mechanical ventilation and 2 154(27.2%) required intubation. Of all the mechanically ventilated patients, VAP occurred in 95 patients. The overall VAP rate was 7.0 episodes per 1 000 ventilator days, varying from 0 to 34.4 episodes per 1 000 ventilator days in different centers. The incidence of VAP was 9.6 and 6.0 per 1 000 ventilator days in children′s hospitals and maternity-infant hospitals respectively, without significant differences (t=1.002, P=0.327). Gram-negative bacilli (76 strains, 91.6%) were the primary VAP microorganisms, mainly Acinetobacter baumannii (24 strains, 28.9%), Klebsiella pneumonia (23 strains, 27.7%), and Pseudomonas aeruginosa (10 strains, 12.0%). Conclusion The incidence of VAP in China is similar to that in developed counties, with substantial variability in different NICU settings. More efforts are needed to monitor and evaluate the preventable factors associated with VAP and conduct interventions that could effectively reduce the occurrence of VAP.