Objective:To explore therapeutic effect of atorvastatin on inflammatory factor levels and vascular endothelial function in patients with coronary heart disease (CHD).Methods: A total of 112 CHD patients treated in our hospital were selected.According to random number table, they were randomly and equally divided into routine treatment group and atorvastatin group, and both groups were treated for eight weeks.Serum levels of inflammatory factors and vascular endothelial function before and after treatment, angina pectoris and ECG therapeutic effect after treatment, and incidence of adverse reactions during medication were compared between two groups.Results: Compared with before treatment, after treatment, there were significant reductions in serum levels of interleukin (IL)-6, tumor necrosis factor (TNF)-α, C reactive protein (CRP), intercellular adhesion molecule (ICAM)-1 and endothelin (ET)-1, and significant rise in nitric oxide (NO) level, left ventricular ejection fraction (LVEF) and cardiac output (CO) in both groups,P<0.01 all;compared with routine treatment group after treatment, there were significant reductions in serum levels of IL-6 [(157.42±30.13) pg/ml vs.(129.83±27.31) pg/ml], TNF-α [(25.41±2.67) ng/L vs.(21.38±2.13) ng/L], CRP [(19.87±2.78) mg/L vs.(17.13±2.04) mg/L], ICAM-1 [(81.23±19.83) pg/ml vs.(64.31±15.46) pg/ml] and ET-1 [(1.45±0.34) pg/ml vs.(0.87±0.23) pg/ml], and significant rise in NO level [(53.27±5.31) mmol/L vs.(58.72±5.46) mmol/L], LVEF [(52.37±5.38)% vs.(63.19±5.79)%] and CO [(4.58±0.78) L/min vs.(5.13±0.82) L/min] in atorvastatin group, P<0.01 all.Compared with routine treatment group, there were significant rise in total effective rates of angina pectoris (73.22% vs.89.29%) and ECG (66.07% vs.83.93%) in atorvastatin group, P<0.05 both.There were no serious adverse drug reactions in two groups.Conclusion: Atorvastatin can significantly improve inflammation state and vascular endothelial function in patients with coronary heart disease.

Objective To analyze the clinical manifestations,treatment and prognosis of adult medulloblastoma (MB).Methods A total of 163 cases of adult MB,confirmed by surgical and pathological diagnosis,were retrospectively analyzed about the clinical manifestations,imaging,treatment and prognosis.There are 108 males and 55 females in the group,whose average age was 28.6-year-old.Results The main clinical manifestations include headache,nausea,vomiting,dizziness,gait disturbance,hypopsia,diplopia,hearing loss and cerebellum crisis.Gross total resection was achieved in 90 cases,subtotal resection in 67 cases and biopsy in 6 cases.Survival time from surgery to progression or death or the last date of follow-up were measured and estimated by the Kaplan-Meier method.Among a total of 160 follow-up patients with MB,postoperative overall survival time was from 7 to 170 months,median survival time was (127±6) months (95％ CI 115.3-138.68).The 5-year overall survival time of adult MB patients was 73.1％ (120/163).The log-rank test was used to compare the significance of the following prognostic variables.Among all clinical factors,patients undergoing the craniospinal irradiation had a significantly better survival rate than those without this treatment (44 months vs 34 months,x2 =8.712,P =0.003).Conclusion Good therapeutic effect of MB be achieved by adopting surgical resection with early enough craniospinal irradiation.Recurrence and metastasis are the two main factors for bad prognosis in adult MB.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To summarize the clinical features of bee sting caused aute kidney injury in children and the effect of he-modialysis therapy .Methods 60 children cases of bee sting caused acute renal injury were performed the retrospective analysis on the clinical features and laboratory data .Results Cystatin C ,serum creatinine ,blood urea nitrogen in children patients with acute kidney injury after hemodialysis were significantly decreased ,while procalcitonin ,high-sensitivity C-reactive protein ,acidosis and e-lectrolyte imbalance also were corrected or improved .After hemodialysis in 60 children cases ,45 cases were clinically cured ,13 cases were significantly improved and discharged and 2 cases died .Conclusion Bee sting is most likely to result in children acute renal in-jury .Hemodialysis is safe and effective treatment measures for acute kidney injury ,can actively improve the renal function without significant complications of acid-base balance and electrolyte imbalance .But the prognosis is closely related with the onset age of the aute kidney injury ,injury severity ,where or not accompanied by MOF ,opportunity of diagnose and treatment ,etc .

OBJECTIVETo investigate the role of caspase-3 and its inhibitor Ac-DEVD-CHO in rat lens epithelial cell apoptosis induced by hydrogen peroxide (H(2)O(2)) in vitro.

METHODSRat lenses were incubated in modified Eagle's medium containing 2 mmol/L H(2)O(2) to induce apoptosis in vitro. Apoptosis in lens epithelial cells was assessed by transmission electron microscopy and annexin V-propidium iodide (PI) double staining flow cytometry after 12, 24 and 48 h of incubation. The activity of caspase-3 was analyzed by western blotting.

RESULTSObservations under transmission electron microscopy revealed that 2 mmol/L H(2)O(2) could effectively induce lens epithelial cell apoptosis in vitro. Caspase-3 activity increased during cell apoptosis and the peak measurement occurred at 24 h after treatment with H(2)O(2). Cell apoptosis was blocked by caspase-3 inhibitor Ac-DEVD-CHO.

CONCLUSIONSThe activation of caspase-3 plays an important role in executing apoptosis in H(2)O(2)-treated lens epithelial cells and in the formation of cataract. The caspase-3 inhibitor Ac-DEVD-CHO may effectively prevent lens epithelial cell apoptosis caused by oxidative injury.

Animals ; Apoptosis ; drug effects ; Caspase 3 ; Caspase Inhibitors ; Caspases ; metabolism ; physiology ; Cysteine Proteinase Inhibitors ; pharmacology ; Enzyme Activation ; Epithelial Cells ; cytology ; Female ; Hydrogen Peroxide ; pharmacology ; Lens, Crystalline ; cytology ; Oligopeptides ; pharmacology ; Organ Culture Techniques ; Rats ; Rats, Sprague-Dawley

Objective:To analyze the influencing factors and improvement paths of the cultivation of full-time doctoral scientific and technological innovation ability in large public hospitals, and propose countermeasures and suggestions.Methods:This studyed conducted a survey and analysis of 122 doctors from Linyi People′s Hospital in Shandong Province, and completed a current situation study based on the analysis results.Results:There was no significant difference between the two groups in gender, age, degree type, professional category, discipline level, Graduate School type, job type and other indicators. There were significant differences between the two groups in scientific research topic selection ability score, project design ability score, data analysis ability score, data interpretation ability score, project approval in recent 5 years, project level, number of SCI journal papers published in recent 5 years, cumulative impact factors of SCI journal papers, and annual number of academic activities ( P<0.05). Conclusions:The hospital can improve the scientific and technological innovation ability of full-time doctors by setting up a special cultivation plan, establishing an interdisciplinary team, optimizing scientific research management services, improving the evaluation and assessment system, and improving welfare protection.

OBJECTIVETo probe into the new idea along with establishment of a novel method for dynamic monitoring and early-warning on the wild resources of traditional Chinese medicines (TCMs).

METHODThe alterations of wild traditional Chinese medicinal resources were assessed through the price ratio between drug and foodstuff (PRDF) indicating the balance between supply and demand of the specific TCMs, referred to the price ration between pork to foodstuff which is used in national monitoring to the balance between pork supply and demand.

RESULTSince the price of rice was tightly controlled by government, it was selected as a relatively stable reference to build the PRDF in order to take away the non-marketing influence to TCMs price such as CPI and inflation rate. The modified relative alteration trend of TCMs price had been researched through comparing different formulae to build PRDF, including absolute average month price of TCMs, month average price ratio of TCMs to foodstuff (rice) , month-on-month change of TCMs to rice, year-on-year change of TCMs to rice, and difference in value of period-on-period change (DVPPC). In the research, Cordyceps, Glycyrrhiza and totally five herbs were selected as model drugs and the price data were collected from 2002 to 2008. The results showed that DVPPC calculated of relative long time window was more sensitive and stable to reflect the relative alteration trend of TCMs price. For instance, the DVPPC of Ligustici showed continuously increase trend in recent years. This suggested appearance of unbalance between supply and demand of Ligustici, and forced policy intervention to maintain reasonable and continuable utilization of Ligustici resource.

CONCLUSIONThe proposed method and the formula of DVPPC revealed some useful guidance for dynamic monitoring the wild resources of TCMs.

Conservation of Natural Resources ; economics ; Food ; economics ; Medicine, Chinese Traditional ; economics ; Nonlinear Dynamics

Objective To study the molecular mechanism of cisplatin to enhance the ability of tumor necrosis factor?related apoptosis?inducing ligand ( TRAIL ) in reversing multidrug resistance in vincristine?resistant human gastric cancer SGC7901/VCR cells. Methods MTT assay was used to measure the 50% inhibiting concentration( IC50 ) and cell survival in SGC7901 and SGC7901/VCR cells after different treatments.SGC7901/VCR cells were treated with different concentrations of DDP, different concentrations of TRAIL alone or in combination, and then the mRNA and protein levels of several genes were determined by RT?PCR, RT?qPCR and Western?blot analysis. After targeted silencing with specific siRNA and transfection of recombinant plasmid c?myc into the SGC7901/VCR cells, the mRNA and protein levels of DR4, DR5 and c?myc were determined by RT?PCR and Western?blot analysis. Results After combined treatment with TRAIL and DDP of the SGC7901/VCR cells, the IC50 of VCR, DDP, ADM, and 5?Fu treatment was significantly decreased compared with the control group or TRAIL?treated group (P<0.05). After treatment with 0, 10, 50 ng/ml TRAIL in combination with 0. 4 μg/ml DDP, the SGC7901/VCR cells showed significantly higher activation of caspase 3, down?regulation of DNA?PKcs/Akt/GSK?3β signaling pathway, and higher inhibition of MDR1(P?gp) and MRP1 than those treated with TRAIL alone (P<0.01 for all). The mRNA and protein levels of DR4, DR5, c?myc were significantly decreased after silencing c?myc with specific siRNA in the SGC7901/VCR cells ( P<0. 01 for all ) , and were significantly increased after transfection of recombinant plasmid c?myc into the SGC7901/VCR cells (P<0.01 foe all). After the treatment with 10 ng/ml TRAIL, 0. 25 μg/ml DDP+10 ng/ml TRAIL and 0. 5 μg/ml DDP+10 ng/ml TRAIL, the relative expression level of c?myc protein in the SGC7901/VCR cells was 0.314±0.012, 0.735±0.026, and 0.876±0.028, respectively, and the relative expression of cytochrome C was 0.339±0.036, 0.593±0.020 and 0.735±0.031, respectively, and the relative expression levels of DR4, DR5, active?caspase 3 and active?caspase 9 in the SGC7901/VCR cells were also increased along with increasing DDP concentrations. Conclusions The activation of DNA?PKcs/Akt/GSK?3β signaling pathway and high expression of MDR1 and MRP1 play an important role in the multi?drug resistance properties of SGC7901/VCR cells. After combining with TRAIL, DDP can enhance the expression of DR4 and DR5 through up?regulating c?myc and enhancing the activation of caspase 3 and caspase 9 by facilitating mitochondrial release of cytochrome C. It may be an important molecular mechanism of DDP?induced sensitization of TRAIL to reverse the multidrug resistancein SGC7901/VCR cells.

Objective To study the molecular mechanism of cisplatin to enhance the ability of tumor necrosis factor?related apoptosis?inducing ligand ( TRAIL ) in reversing multidrug resistance in vincristine?resistant human gastric cancer SGC7901/VCR cells. Methods MTT assay was used to measure the 50% inhibiting concentration( IC50 ) and cell survival in SGC7901 and SGC7901/VCR cells after different treatments.SGC7901/VCR cells were treated with different concentrations of DDP, different concentrations of TRAIL alone or in combination, and then the mRNA and protein levels of several genes were determined by RT?PCR, RT?qPCR and Western?blot analysis. After targeted silencing with specific siRNA and transfection of recombinant plasmid c?myc into the SGC7901/VCR cells, the mRNA and protein levels of DR4, DR5 and c?myc were determined by RT?PCR and Western?blot analysis. Results After combined treatment with TRAIL and DDP of the SGC7901/VCR cells, the IC50 of VCR, DDP, ADM, and 5?Fu treatment was significantly decreased compared with the control group or TRAIL?treated group (P<0.05). After treatment with 0, 10, 50 ng/ml TRAIL in combination with 0. 4 μg/ml DDP, the SGC7901/VCR cells showed significantly higher activation of caspase 3, down?regulation of DNA?PKcs/Akt/GSK?3β signaling pathway, and higher inhibition of MDR1(P?gp) and MRP1 than those treated with TRAIL alone (P<0.01 for all). The mRNA and protein levels of DR4, DR5, c?myc were significantly decreased after silencing c?myc with specific siRNA in the SGC7901/VCR cells ( P<0. 01 for all ) , and were significantly increased after transfection of recombinant plasmid c?myc into the SGC7901/VCR cells (P<0.01 foe all). After the treatment with 10 ng/ml TRAIL, 0. 25 μg/ml DDP+10 ng/ml TRAIL and 0. 5 μg/ml DDP+10 ng/ml TRAIL, the relative expression level of c?myc protein in the SGC7901/VCR cells was 0.314±0.012, 0.735±0.026, and 0.876±0.028, respectively, and the relative expression of cytochrome C was 0.339±0.036, 0.593±0.020 and 0.735±0.031, respectively, and the relative expression levels of DR4, DR5, active?caspase 3 and active?caspase 9 in the SGC7901/VCR cells were also increased along with increasing DDP concentrations. Conclusions The activation of DNA?PKcs/Akt/GSK?3β signaling pathway and high expression of MDR1 and MRP1 play an important role in the multi?drug resistance properties of SGC7901/VCR cells. After combining with TRAIL, DDP can enhance the expression of DR4 and DR5 through up?regulating c?myc and enhancing the activation of caspase 3 and caspase 9 by facilitating mitochondrial release of cytochrome C. It may be an important molecular mechanism of DDP?induced sensitization of TRAIL to reverse the multidrug resistancein SGC7901/VCR cells.

OBJECTIVETo study the pathologic characteristics and prognosis in different subtypes of adult medulloblastoma (MB).

METHODSThe clinical information, imaging findings and pathologic characteristics of 151 cases of adult medulloblastomas were retrospectively reviewed and analyzed by chi-square test. The survival data were assessed using the Kaplan-Meier method.

RESULTSAmongst the 151 MB cases studied, there were 73 cases of classic MB, 36 cases of desmoplastic/nodular MB, 39 cases of anaplastic MB and 3 cases of large cell MB. The primary tumors were more frequently located in cerebral hemisphere in desmoplastic/nodular MB than in other subtypes (P=0.000).On the other hand, large cell/anaplastic MB were associated with more frequently local recurrence and distant metastasis (P=0.003). The post-operative overall survival time ranged from 6 to 150 months, with median survival being (103.3±5.7) months (95%CI, 92.52 to 115.09). The median survival of classic MB, desmoplastic/nodular MB and large cell/anaplastic MB was (110.7±7.8) months, (125.5±7.6) months and (57.6±7.6) months, respectively. The differences were statistically significant (P=0.000).

CONCLUSIONSThe three variants of MB show different biologic behavior. Large cell/anaplastic MB represents an independent poor prognostic indicator in adults.

Adolescent ; Adult ; Cerebellar Neoplasms ; classification ; metabolism ; pathology ; radiotherapy ; surgery ; Disease-Free Survival ; Female ; Follow-Up Studies ; Glial Fibrillary Acidic Protein ; metabolism ; Humans ; Kaplan-Meier Estimate ; Ki-67 Antigen ; metabolism ; Male ; Medulloblastoma ; classification ; metabolism ; pathology ; radiotherapy ; surgery ; Middle Aged ; Neoplasm Recurrence, Local ; Phosphopyruvate Hydratase ; metabolism ; Radiotherapy, Adjuvant ; Retrospective Studies ; Survival Analysis ; Synaptophysin ; metabolism ; Young Adult