1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Fresh Rehmanniae Radix regulates cholesterol metabolism disorder in mice fed with high-fat and high-cholesterol diet via FXR-mediated bile acid reabsorption.
Xin-Yu MENG ; Yan CHEN ; Li-Qin ZHAO ; Qing-Pu LIU ; Yong-Huan JIN ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(6):1670-1679
This study aims to investigate the potential effect of the water extract of fresh Rehmanniae Radix on hypercholesterolemia in mice that was induced by a high-fat and high-cholesterol diet and explore its possible mechanism from bile acid reabsorption. Male C57BL/6 mice were randomly assigned into the following groups: control, model, low-and high-dose(4 and 8 g·kg~(-1), respectively) fresh Rehmanniae Radix, and positive drug(simvastatin, 0.05 g·kg~(-1)). Other groups except the control group were fed with a high-fat and high-cholesterol diet for 6 consecutive weeks to induce hypercholesterolemia. From the 6th week, mice were administrated with corresponding drugs daily via gavage for additional 6 weeks, while continuing to be fed with a high-fat and high-cholesterol diet. Serum levels of total cholesterol(TC), triglycerides(TG), low density lipoprotein-cholesterol(LDL-c), high density lipoprotein-cholesterol(HDL-c), and total bile acid(TBA), as well as liver TC and TG levels and fecal TBA level, were determined by commercial assay kits. Hematoxylin-eosin(HE) staining, oil red O staining, and transmission electron microscopy were performed to observe the pathological changes in the liver. Three livers samples were randomly selected from each of the control, model, and high-dose fresh Rehmanniae Radix groups for high-throughput transcriptome sequencing. Differentially expressed genes were mined and KEGG pathway enrichment analysis was performed to predict the key pathways and target genes of the water extract of fresh Rehmanniae Radix in the treatment of hypercholesterolemia. RT-qPCR was employed to measure the mRNA levels of cholesterol 7α-hydroxylase(CYP7A1) and cholesterol 27α-hydroxylase(CYP27A1) in the liver. Western blot was employed to determine the protein levels of CYP7A1 and CYP27A1 in the liver as well as farnesoid X receptor(FXR), apical sodium-dependent bile acid transporter(ASBT), and ileum bile acid-binding protein(I-BABP) in the ileum. The results showed that the water extract of fresh Rehmanniae Radix significantly lowered the levels of TC and TG in the serum and liver, as well as the level of LDL-c in the serum. Conversely, it elevated the level of HDL-c in the serum and TBA in feces. No significant difference was observed in the level of TBA in the serum among groups. HE staining, oil red O staining, and transmission electron microscopy showed that the water extract reduced the accumulation of lipid droplets in the liver. Further mechanism studies revealed that the water extract of fresh Rehmanniae Radix significantly down-regulated the protein levels of FXR and bile acid reabsorption-related proteins ASBT and I-BABP. Additionally, it enhanced CYP7A1 and CYP27A1, the key enzymes involved in bile acid synthesis. Therefore, it is hypothesized that the water extract of fresh Rehmanniae Radix may exert an anti-hypercholesterolemic effect by regulating FXR/ASBT/I-BABP signaling, inhibiting bile acid reabsorption, and increasing bile acid excretion, thus facilitating the conversion of cholesterol to bile acids.
Animals
;
Male
;
Bile Acids and Salts/metabolism*
;
Mice, Inbred C57BL
;
Mice
;
Diet, High-Fat/adverse effects*
;
Cholesterol/metabolism*
;
Drugs, Chinese Herbal/administration & dosage*
;
Hypercholesterolemia/genetics*
;
Receptors, Cytoplasmic and Nuclear/genetics*
;
Rehmannia/chemistry*
;
Liver/drug effects*
;
Humans
;
Cholesterol 7-alpha-Hydroxylase/genetics*
;
Plant Extracts
3.Caffeoylquinic acids from Erigeron breviscapus ameliorates cognitive impairment and mitochondrial dysfunction in AD by activating PINK1/Parkin-mediated mitophagy.
Yuan-Zhu PU ; Hai-Feng CHEN ; Xin-Yi WANG ; Can SU
China Journal of Chinese Materia Medica 2025;50(14):3969-3979
This study aimed to investigate the effects of caffeoylquinic acids from Erigeron breviscapus(EBCQA) on cognitive impairment and mitochondrial dysfunction in Alzheimer's disease(AD), and to explore its underlying mechanisms. The impacts of EBCQA on paralysis, β-amyloid(Aβ) oligomerization, and mRNA expression of mitophagy-related genes [PTEN-induced putative kinase 1(PINK1) homolog-encoding gene pink-1, Parkin homolog-encoding gene pdr-1, Bcl-2 interacting coiled-coil protein 1(Beclin 1) homolog-encoding gene bec-1, microtubule-associated protein 1 light chain 3(LC3) homolog-encoding gene lgg-1, autophagic adapter protein 62(p62) homolog-encoding gene sqst-1] were examined in the AD Caenorhabditis elegans CL4176 model, along with mitochondrial functions including adenosine triphosphate(ATP) content, enzyme activities of mitochondrial respiratory chain complexes Ⅰ,Ⅲ, and Ⅳ, and mitochondrial membrane potential. Additionally, the effects of EBCQA on the green fluorescent protein(GFP)/red fluorescent protein from Discosoma sp.(DsRed) ratio, the expression of phosphatidylethanolamine-modified and GFP-labeled LGG-1(PE-GFP::LGG-1)/GFP-labeled LGG-1(GFP::LGG-1), and GFP-labeled SQST-1(GFP::SQST-1) proteins were investigated in transgenic C. elegans strains. The effect of EBCQA on paralysis was further evaluated after RNA interference(RNAi)-mediated suppression of the pink-1 and pdr-1 genes in CL4176 strain. An AD rat model was established through intraperitoneal injection of D-galactose and intragastric administration of aluminum trichloride. The effects of β-nicotinamide mononucleotide(NMN) and EBCQA on learning and memory ability, neuronal morphology, mitophagy occurrence, mitophagy-related protein expression(PINK1, Parkin, Beclin 1, LC3-Ⅱ/LC3-Ⅰ, p62), and mitochondrial functions(ATP content; enzyme activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ; mitochondrial membrane potential) were investigated in this AD rat model. The results showed that EBCQA delayed paralysis onset in the CL4176 strain, reduced Aβ oligomer formation, and upregulated the mRNA expression levels of lgg-1, bec-1, pink-1, and pdr-1, while downregulating sqst-1 mRNA expression. EBCQA also enhanced ATP content, mitochondrial membrane potential, and the activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ. Furthermore, EBCQA improved the PE-GFP::LGG-1/GFP::LGG-1 ratio, reduced GFP::SQST-1 expression, and decreased the GFP/DsRed ratio. Notably, the ability of EBCQA to delay paralysis was significantly reduced following RNAi-mediated suppression of pink-1 and pdr-1 in CL4176 strain. In AD rats, the administration of NMN or EBCQA significantly improved learning and memory, restored neuronal morphology in the hippocampus, increased autophagosome numbers, and upregulated the expression of PINK1, Parkin, Beclin 1, and the LC3-Ⅱ/LC3-Ⅰ ratio, while reducing p62 expression. Additionally, the treatment with NMN or EBCQA both elevated ATP content, mitochondrial respiratory chain complex Ⅰ, Ⅲ, and Ⅳ activities, and mitochondrial membrane potential in the hippocampus. The above findings indicate that EBCQA improves cognitive impairment and mitochondrial dysfunction in AD, possibly through activation of PINK1/Parkin-mediated mitophagy.
Animals
;
Alzheimer Disease/psychology*
;
Mitophagy/drug effects*
;
Mitochondria/genetics*
;
Caenorhabditis elegans/metabolism*
;
Ubiquitin-Protein Ligases/genetics*
;
Cognitive Dysfunction/physiopathology*
;
Rats
;
Protein Kinases/genetics*
;
Humans
;
Male
;
Disease Models, Animal
;
Caenorhabditis elegans Proteins/genetics*
;
Drugs, Chinese Herbal/administration & dosage*
4.Advances in Lung Cancer Treatment: Integrating Immunotherapy and Chinese Herbal Medicines to Enhance Immune Response.
Yu-Xin XU ; Lin CHEN ; Wen-da CHEN ; Jia-Xue FAN ; Ying-Ying REN ; Meng-Jiao ZHANG ; Yi-Min CHEN ; Pu WU ; Tian XIE ; Jian-Liang ZHOU
Chinese journal of integrative medicine 2025;31(9):856-864
5.Rapid discovery of drug-introduced multiple organ dysfunction via NIR-II fluorescent imaging.
Pu JIANG ; Ruihu SONG ; Yue HU ; Xin HE ; Zewei ZHANG ; Xuemei WEI ; Zhiming WANG ; De-An GUO ; Hao CHEN
Acta Pharmaceutica Sinica B 2025;15(8):4285-4299
The precise and rapid monitoring of multiple organ dysfunction is crucial in drug discovery. Traditional methods, such as pathological analysis, are often time-consuming and inefficient. Here, we developed a multiplexed near-infrared window two (NIR-II) fluorescent bioimaging method that allows for real-time, rapid, and quantitative assessment of multiple organ dysfunctions. Given that existing probes did not fully meet requirements, we synthesized a range of NIR-II hemicyanine dyes (HDs) with varying absorption and emission wavelengths. By modifying these dyes, we achieved high spatial and temporal resolution imaging of the liver, kidneys, stomach, and intestines. This method was further applied to investigate disorders induced by cisplatin, a drug known to cause gastric emptying issues along with liver and kidney injuries. By monitoring the metabolic rate of the dyes in these organs, we accurately quantified multi-organ dysfunction, which was also confirmed by gold-standard pathological analysis. Additionally, we evaluated the effects of five aristolochic acids (AAs) on multiple organ dysfunction. For the first time, we identified that AA-I and AA-II could cause gastric emptying disorders, which was further validated through transcriptomics analysis. Our study introduces a novel approach for the simultaneous monitoring of multi-organ dysfunction, which may significantly enhance the evaluation of drug side effects.
6.Longitudinal Associations between Vitamin D Status and Systemic Inflammation Markers among Early Adolescents.
Ting TANG ; Xin Hui WANG ; Xue WEN ; Min LI ; Meng Yuan YUAN ; Yong Han LI ; Xiao Qin ZHONG ; Fang Biao TAO ; Pu Yu SU ; Xi Hua YU ; Geng Fu WANG
Biomedical and Environmental Sciences 2025;38(1):94-99
7.Role of podoplanin in hepatic stellate cell activation and liver fibrosis
Zhiyi WANG ; Guangyue YANG ; Wei ZHANG ; Yaqiong PU ; Xin ZHAO ; Wenting MA ; Xuling LIU ; Liu WU ; Le TAO ; Cheng LIU
Journal of Clinical Hepatology 2024;40(3):533-538
ObjectiveTo investigate the role and mechanism of podoplanin (PDPN) in hepatic stellate cell (HSC) activation and liver fibrosis. MethodsLiver biopsy samples were collected from 75 patients with chronic hepatitis B who attended Department of Infectious Diseases, Putuo Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, for the first time from September 2019 to June 2022, and RT-PCR and immunohistochemistry were used to measure the expression of PDPN in liver tissue of patients in different stages of liver fibrosis. A total of 12 male C57/BL6 mice were randomly divided into control group and model group. The mice in the model group were given intraperitoneal injection of 10% CCl4, and those in the control group were injected with an equal volume of olive oil, for 6 weeks. HE staining and Sirius Red staining were used to observe liver histopathological changes; primary mouse liver cells were separated to measure the mRNA expression of PDPN in various types of cells; primary mouse HSCs were treated with PDPN protein, followed by treatment with the NF-κB inhibitor BAY11-708, to measure the expression of inflammatory factors in HSCs induced by PDPN. The independent-samples t test was used for comparison of normally distributed continuous data between two groups; a one-way analysis of variance was used for comparison between multiple groups, and the least significant difference t-test was used for further comparison between two groups. The Spearman correlation analysis was used to investigate data correlation. ResultsAs for the liver biopsy samples, there was a relatively low mRNA expression level of PDPN in normal liver, and there was a significant increase in the mRNA expression level of PDPN in liver tissue of stage S3 or S4 fibrosis (all P<0.001). Immunohistochemical staining showed that PDPN was mainly expressed in the fibrous septum and the hepatic sinusoid, and the PDPN-positive area in S4 liver tissue was significantly higher than that in S0 liver tissue (t=8.892, P=0.001). In normal mice, PDPN was mainly expressed in the hepatic sinusoid, and there was a significant increase in the expression of PDPN in CCl4 model mice (t=0.95, P<0.001), mainly in the fibrous septum. RT-PCR showed a significant increase in the mRNA expression of PDPN in the CCl4 model mice (t=11.25, P=0.002). Compared with hepatocytes, HSCs, Kupffer cells, and bile duct endothelial cells, hepatic sinusoidal endothelial cells showed a significantly high expression level of PDPN (F=20.56, P<0.001). Compared with the control group, the primary mouse HSCs treated by PDPN protein for 15 minutes showed significant increases in the mRNA expression levels of the inflammation-related factors TNFα, CCL3, CXCL1, and CXCR1 (all P<0.05), and there were significant reductions in the levels of these indicators after treatment with BAY11-7082 (all P<0.05). ConclusionThere is an increase in the expression of PDPN mainly in hepatic sinusoidal endothelial cells during liver fibrosis, and PDPN regulates HSC activation and promotes the progression of liver fibrosis via the NF-κB signaling pathway.
8.Correlation between interleukin 1β-511C/T polymorphism and essential hypertension in the Yi ethnic group of Yunnan province
Tong YANG ; Yuan XU ; Xingyun PU ; Yiting MA ; Jing YANG ; Xin SHU ; Hongyu PENG ; Yanrui WU ; Li LONG
Basic & Clinical Medicine 2024;44(12):1651-1655
Objective To investigate the correlation between interleukin 1β gene-511C/T polymorphism of and essential hypertension in the Yi ethnic group of Yunnan province.Methods-511C/T polymorphism of interleukin 1β gene was detected by PCR-RFLP in 85 Yi patients with essential hypertension(EH group)and 106 Yi healthy people(control group)in Shuanghe Township,Jinning County,Yunnan Province.Genotype and allele frequencies were analyzed by SPSS 27.0 software,and association analysis was performed.Results The frequency distribution of CC,CT and TT genotypes at the mutation site 511 of the IL-1βgene in EH group was 18.82%,44.71%and 36.47%,respectively,and it was 5.66%,26.42%and 67.92%in the control group.The difference in genotype frequency between the two groups was statistically significant(P<0.05).The allele frequency of C and T in EH group was 41.18%and 58.82%,respectively,and the allele frequency of C and T in control group was 18.87%and 81.13%.The frequency difference of alleles between the two groups was statistically significant(P<0.05).Both genotype frequency and allele frequency found in males and females had statistical differences(P<0.05).Conclusions The distribution of IL-1β gene-511C/T polymorphism is related to the incident of essential hyper-tension among the Yi ethnic group Yunnan Province,and is the susceptibility gene of the Yi ethnic group to essen-tial hypertension.
9.Evaluation of the effect of the"tertiary hospital-community integrated"TCM-based management and treatment program in 60 patients with diabetic kidney disease
Xueying HUANG ; Ning ZHANG ; Kaifeng SHI ; Pu YAN ; Xiangyu LI ; Qian ZHANG ; Xin WANG ; Guozhao YAO ; Ying HUANG ; Tongxia LI
Journal of Beijing University of Traditional Chinese Medicine 2024;47(1):107-115
Objective We aimed to observe the effect of the traditional Chinese medicine(TCM)-based"tertiary hospital-community integrated"treatment program in patients with diabetic kidney disease.Methods A total of 126 patients from the Jiangtai and Cuigezhuang Communities in Chaoyang District were randomly divided into the experimental group and the control group(n=63 patients per group).In the experimental group,the"tertiary hospital-community integrated"treatment program was implemented(including TCM differentiated health preservation,chronic disease management,comprehensive diagnosis and treatment program of integrated Chinese and Western medicine),while in the control group,the existing chronic disease diagnosis,treatment,and management program in the community was implemented(including chronic disease management with regular follow-ups,diagnosis and treatment program of Western medicine).The observation period was 6 months,with 3 months as a course of treatment.The 24 h urine total protein level(24 hUTP),the serum level of creatinine(Scr),and the estimated glomerular filtration rate(eGFR)were compared between the two groups,as well as the effective rates of 24 hUTP,Scr,and eGFR,the rate of achieving standard glucose levels and normal lipid metabolism,including low-density lipoprotein-cholesterol(LDL-C),triglyceride(TG),and glycosylated hemoglobin(GHB),the level of patients'self-management,and the medical service in utilization.Results There were 120 patients included for analysis(60 in the experimental group and 60 in the control group).The difference in 24 hUTP was significantly different(P<0.05),while Scr and eGFR were not statistically different between the experimental and control groups after 3 months of treatment.The differences in 24 hUTP,Scr,and eGFR were statistically significant after 6 months(P<0.05).After 6 months of treatment in both groups,the effective rates of 24 hUTP,Scr,and eGFR were higher in the experimental group than in the control group(78.3%,48.3%,and 50.0%in the experimental group and 35.0%,18.3%,and 15.0%in the control group,respectively)(P<0.05);after 6 months,the LDL-C,TG,and GHB qualified rates were higher in the experimental group than in the control group(75.0%,83.3%,and 71.7%in the experimental group and 56.7%,63.3%,and 46.7%in the control group,respectively;P<0.05);comparing the self-management levels of the two groups after 3 and 6 months of treatment,the total self-management score and the total self-efficacy score were both higher in the experimental group than in the control group(P<0.05);comparing the time of hospitalization and hospitalization costs of the two groups 6 months after enrollment,the time of hospitalization and hospitalization costs were lower in the experimental group(P<0.05).Conclusion The"tertiary hospital-community integrated"TCM-based treatment program improves renal function,glucose and lipid metabolism,and patients'self-management;it can reduce the economic burden of families,save medical resources,and improve the utilization of medical services.
10.Efficacy of Yiqi Wenyang Huwei Decoction on airway inflammation in bronchial asthma in rats based on IL-25/NF-κB signaling pathway
A-Xin XIA ; Shuang-Di XIANG ; Xiao-Pu SU ; Shuai-Liang HUANG ; Jian-Wei YU
Chinese Traditional Patent Medicine 2024;46(2):431-436
AIM To explore the mechanism of Yiqi Wenyang Huwei Decoction on airway inflammation improvement of rats with bronchial asthma based on IL-25/NF-κB signaling pathway.METHODS 60 rats were randomly divided into the control group,the model group,the dexamethasone group(0.2 mg/mL),the low-dose,medium-dose and high-dose Yiqi Wenyang Huwei Decoction groups(1,2,4 g/mL),with 10 rats in each group.Intraperitoneal injection of ovalbumin(OVA)and aluminum hydroxide suspension was applied to establish the rat asthma model,followed by 2-week corresponding dosing of the drugs.The rats of each group had their daily diet,mental status,hair growth and respiration observed;their differential count of inflammatory cells in bronchoalveolar lavage fluid(BALF)detected by automatic hematology analyzer;their pathological changes of lung tissue observed by HE staining;their pulmonary IL-25 protein expression detected by immunohistochemistry(IHC);their levels of IL-4,IL-5 and IL-13 in BALF measured by ELISA;their pulmonary expression of IL-25 and TRAF6 mRNA detected by RT-qPCR;and their pulmonary protein expressions of IL-25,TRAF6,IκBα,p-IκBα,NF-κB p65 and p-NF-κB p65 detected by Western blot.RESULTS Compared with the control group,the model group displayed severe damage of the lung tissue and infiltration of a large number of inflammatory cells;increased number of inflammatory cells and levels of IL-4,IL-5 and IL-13 in BALF(P<0.01);increased mRNA expressions of IL-25 and TRAF6,and pulmonary protein expressions of IL-25,TRAF6,p-IκBα/IκBα and p-NF-κB p65/NF-κB p65(P<0.01).Compared with the model group,all of the Yiqi Wenyang Huwei Decoction groups shared improved pulmonary infiltration of inflammatory cells;decreased number of inflammatory cells and levels of IL-4,IL-5 and IL-13 in BALF(P<0.05,P<0.01);and decreased mRNA expressions of IL-25 and TRAF6,and pulmonary protein expressions of IL-25,TRAF6,p-IκBα/IκBα and p-NF-κB p65/NF-κB p65(P<0.01).CONCLUSION Yiqi Wenyang Huwei Decoction can inhibit the airway inflammation in the rat model of bronchial asthma,which may be related to the inhibited activation of IL-25/NF-κB signaling pathway and the reduced expression of inflammatory factors.

Result Analysis
Print
Save
E-mail