Objective To explore the effect of transabdominal posterior rectopexy with resection of the partial rectosigmoid colon on adult rectal prolapse.Methods During the 2006 to 2011,transabdominal posterior rectopexy with resection of the partial rectosigmoid colon was performed on 6 selected adult patients with complete rectal prolapse.Results All patients were cured,the median length of hospital stay was 13.7 days.Followed up for 3-61 months,there was no recurrent case.Conclusions The operation offers a safe and effective alternative to other more complex procedures for the treatment of adult rectal prolapse.The procedure can not only treat the rectosigmoid disease,but also improve the rectosigmoid disease,improve the function of bowel and reduce the recurrence rate.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Objective To introduce the application of multiplex ligation-dependent probe amplification (MLPA) assays in the diagnosis of patients with hereditary neuropathy with liability to pressure palsies (HNPP).Methods Copy numbers of the exons in peripheral myelin prolein 22 (PMP22) gene,tektin 3 (TEKT3) gene and cytochrome c oxidase assembly protein 10 (COX10) gene were analyzed by MLPA in 8 patients diagnosed with HNPP clinically and 5 normal controls.Results Among the 8 patients,7 patients were identified to have deletion mutations according to their reduced peak area of PMP22 gene,TEKT3 gene and COX10 gene compared with that of normal controls.One patient with normal peak area of PMP22 gene,TEKT3 gene and COX10 gene showed no deletion of these genes.Conclusions MLPA assays can detect the copy numbers of genes in HNPP region through semi-quantitative analysis in a rapid,accurate way,which may be utilized widely in the genetic diagnosis among HNPP patients.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Objective To explore the diagnostic value of serum ficolin-3(FCN3)and collagen triple helix repeat containing-1(CTHRC1)in non-small cell lung cancer(NSCLC)and their relationship with clinicopathological characteristics.Methods From July 2021 to August 2022,73 patients with NSCLC who were admitted to the our Hospital were selected as the study group,and 55 healthy people who came to our hospital for physical examination were regarded as the control group.the serum levels of FCN3 and CTHRC1 were measured by enzyme-linked immunosorbent assay(ELISA);Pearson method was applied to analyze the correlation of serum FCN3 and CTHRC1 levels in NSCLC patients;Logistic regression analysis was applied to analyze the influencing factors of NSCLC;the diagnostic value of serum FCN3 and CTHRC1 levels on the occurrence of NSCLC was analyzed by the ROC curve.Results The levels of serum FCN3 and CTHRC1 in the study group were obviously higher than those in the control group(P＜0.05);the levels of serum FCN3 and CTHRC1 were correlated with the degree of cancer cell differentiation,TNM stage and lymph node metastasis in NSCLC patients(P＜0.05);Pearson method analysis showed that there was a positive correlation between serum FCN3 and CTHRC1 levels in NSCLC patients(r=0.258,P=0.028);Logistic regression analysis showed that serum FCN3 and CTHRC1 were the influencing factors of NSCLC(P＜0.05);the area under the ROC curve of serum FCN3 and CTHRC1 levels in diagnosis of NSCLC was 0.869 and 0.810,respectively,the area under the ROC curve of NSCLC was 0.881,which were better than those of serum FCN3 and CTHRC1.Conclusion The levels of serum FCN3 and CTHRC1 in patients with NSCLC increase,which are related to the degree of cancer cell differentiation,TNM stage and lymph node metastasis,they are risk factor for NSCLC,and the combination of the two is more valuable in diagnosis of NSCLC.

Most of the neurogenetic disorders could not be cured until now. With the development of molecular biological techniques, gene therapies show brilliant application prospects in neurogenetic disorders, which contain gene supplementation, exon skipping, splicing enhancement, dynamic mutation correction and toxic expression product elimination, and so on.

To study alkaloid constituents in Corydalis decumbens,thirteen compounds were isolated from 95％ ethanol extracts of Corydalis decumbens (Thunb) Pers.by silica gel,RP-C1s,Sephadex LH-20 column chromatographer,recry stallization,thin-layer chromatography and HPLC.Their structures were elucidated on the basis of spectral data combined with physiochemical properties as tetrahydropalmatine (1),oxyhydrastinine (2),doryanine (3),palmatine (4),bicuculline (5),canadine (6),tetrahydrocoptisine(7),corydaldine (8),epicorynoxidine (9),N-methylcorydaldine (10),(+)-corlumine (11),N-methyl-6,7-dimethoxyisoquinolone (12) and oxysanguinarine (13).Compounds 2,3,6,7,and 9-13 were isolated from this plant for the first time.In addition,compounds 2,3,and 9-13 were obtained firstly from this genus.Pharmacological experiments showed that tetrahydropalmatine (1) might have analgesic or sedative effects,and the bicuculline (5) could probably induce epilepsy.

Objective To investigate the role and possible mechanism of curcumin(Cur)regulating Peroxiredoxin-6(Prdx6)expression in inhibiting Erastin-induced ferroptosis in C28/I2 chondrocytes.Methods Safranin O/Fast Green and hematoxylin-eosin(HE)staining were performed to observe the pathological changes in the knee joint of rats with osteoarthritis(OA).The expression levels of Prdx6 and GPX4 proteins in cartilage tissues with OA were detected by immunohistochemistry and Western blot.C28/I2 chondrocytes were treated with different concentrations of Cur,cell viability was detected by thiazolyl blue tetrazolium bromide(MTT)assay and cytotoxicity was measured by lactic dehydrogenase(LDH)assay.The production of lipid reactive oxygen species(ROS)in chondrocytes was detected by flow cytometry,and the total glutathione(GSH)assay kit was used to detect the GSH level in chondro-cytes.Western blot was performed to detect the expression level of Prdx6 and ferroptosis-related proteins in chon-drocytes.The interaction between the Cur molecule and Prdx6 was analyzed through the molecular docking tech-nique.Results During the OA progression,OA rats and OA patients showed pathological changes such as damage to the cartilage and a decrease in the number of chondrocytes.The expression levels of Prdx6 and GPX4 were re-duced in the cartilage tissues of OA patients compared with healthy people.Further study revealed that the treat-ment of Erastin-induced ferroptosis in C28/I2 chondrocytes in a mouse model with 20 μmol/L of Cur could improve cell viability,decrease cytotoxicity,inhibit lipid ROS production,and increase the level of intracellular GSH.Western blot results showed decreased expression of Prdx6,SLC7A11,FTH,and GPX4 and increased expression of ACSL4.In addition,Cur molecules interacted with Prdx6 protein by van der Waals forces and π bond.Conclu-sion Cur may inhibit Erastin-induced ferroptosis in C28/I2 chondrocytes by upregulating the Prdx6 expression lev-el.