OBJECTIVE: To observe the household environment dust mites allergens content distribution characteristics and influence factors of children with allergic rhinitis to dust mites in Wuhu. METHOD: Collect the surface dust in bedroom and living room floor, mattresses, pillows, sofa of 102 children with allergic rhinitis families. Dust mite allergen components 1 (Der f1) and house dust mites allergens 1 components (Der p1) of the dust samples were determined by enzyme-linked immunosorbent assay (ELISA). RESULT: One hundred and twenty samples were collected . In a domestic dust mites samples, with a median of M (Min and Max) said dust mite allergen levels, Der f1 and Der p1 content was 2.66 (0.03, 26.63), 3.48 (0, 03, 33.68), respectively. Der f1 was significantly less than Der p1, and the difference was statistically significant (P < 0.05). According to the classification of urban and township, there were 68 cases and 34 cases. Der f1 content in the samples was 2.91 (0.31, 26.63), 2.40 (0.08, 16.02), respectively. Der p1 content was 4.28 (0.03, 20.77), 3.88 (0.14, 33.68), respectively. The dust mites content of urban was significantly more than that of villages and towns, the difference was statistically significant (P < 0.05). Samples were also classified by gender. The dust mites allergens content in either boy's or girl's family were similar, there was no statistically significant difference (P > 0.05). CONCLUSION The household dust mites of children allergic rhinitisin Wuhu area is given priority to with Der p1, and urban dust mites are significantly more than village's and town's. Enhancing health education, controlling dust mites allergens contamination inside the bedroom, especially urban areas, are positive differences for the prevention and treatment of allergic diseases such as allergic rhinitis in children.
Allergens ; analysis ; Animals ; Antigens, Dermatophagoides ; analysis ; Arthropod Proteins ; analysis ; Bedding and Linens ; Child ; Cysteine Endopeptidases ; analysis ; Dermatophagoides farinae ; Dust ; analysis ; Enzyme-Linked Immunosorbent Assay ; Female ; Humans ; Male ; Rhinitis, Allergic ; epidemiology

Objective To introduce the application of multiplex ligation-dependent probe amplification (MLPA) assays in the diagnosis of patients with hereditary neuropathy with liability to pressure palsies (HNPP).Methods Copy numbers of the exons in peripheral myelin prolein 22 (PMP22) gene,tektin 3 (TEKT3) gene and cytochrome c oxidase assembly protein 10 (COX10) gene were analyzed by MLPA in 8 patients diagnosed with HNPP clinically and 5 normal controls.Results Among the 8 patients,7 patients were identified to have deletion mutations according to their reduced peak area of PMP22 gene,TEKT3 gene and COX10 gene compared with that of normal controls.One patient with normal peak area of PMP22 gene,TEKT3 gene and COX10 gene showed no deletion of these genes.Conclusions MLPA assays can detect the copy numbers of genes in HNPP region through semi-quantitative analysis in a rapid,accurate way,which may be utilized widely in the genetic diagnosis among HNPP patients.

Objective: To evaluate the effect of bioactive peptides combined with probiotics on serum uric acid (SUA) in patients with hyperuricemia (HUA), so as to provide the evidence for prevention and treatment of HUA. Methods: The patients with HUA aged 18 to 65 years were selected and randomly divided into an intervention group and a control group. The patients in the intervention group received bioactive peptides combined with probiotics for 28 days at a dose of 3 g/d, while the patients in the control group received an equal dose of placebos. Demographic information, body mass index (BMI), blood pressure and blood lipid were collected through questionnaire surveys, physical examination and laboratory tests. SUA levels were detected before and after 14 days and 28 days of interventions. The differences of SUA levels between the two groups were compared using generalized estimation equation. Results: Totally 108 patients with HUA were recruited, including 54 patients in the intervention group and 53 patients in the control group (1 dropout). Before interventions, there were no statistically significant differences in gender, age, course of HUA, exercise duration, frequency of alcohol consumption, frequency of meat broth consumption, BMI, prevalence of hypertension and prevalence of dyslipidemia between the two groups (all P>0.05). After 14 days of interventions, the SUA levels of the patients in the intervention group decreased by 3.00 μmol/L, while those in the control group increased by 7.00 μmol/L. After 28 days of interventions, the SUA levels of the patients in the intervention group and the control group decreased by 26.00 μmol/L and 16.00 μmol/L, respectively. However, there was no statistically significant interaction between the intervention time and group (both P>0.05). Subgroup analysis showed that after 28 days of interventions, the decrease in SUA levels in the patients aged 55 years and older and without hypertension in the intervention group was greater than those in the control group (both P<0.05). Conclusions Bioactive peptides combined with probiotics showed no significant difference in reducing SUA levels in patients with HUA compared to the control group. The effect was more significant for patients aged 55 years and older and without hypertension.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Most of the neurogenetic disorders could not be cured until now. With the development of molecular biological techniques, gene therapies show brilliant application prospects in neurogenetic disorders, which contain gene supplementation, exon skipping, splicing enhancement, dynamic mutation correction and toxic expression product elimination, and so on.

In order to identify rat ovarian germ cells, we expressed and purified rat RVLG protein in Escherichia coli cells and prepared a mouse anti-rat RVLG polyclonal antibody. The rat RVLG cDNA was obtained from rat testicle tissue by RT-PCR and was cloned into the vector pMD19-T. Sequence analysis proves that the cloned RVLG cDNA fragment was 60 bp longer than that released in the GenBank (NM_001077647), resulting from an alternative splicing of the RVLG pre-mRNA. The RVLG cDNA was double digested with the restriction endonucleases BamH I and EcoR I, and then was extracted from gel and inserted into the prokaryotic expression vector pGEX-4T-1. The recombinant expression plasmid pGEX-RVLG was verified for successful construction and then was transformed into Escherichia coli BL21(DE3) for induction to express the GST-RVLG fusion protein by IPTG. The GST-RVLG fusion protein was expressed in Escherichia coli BL21 (DE3) at a high level which accounts for more than 10% of the total bacterial cellular protein. The purified RVLG protein was used as an antigen to immunize KM mouse for the production of polyclonal antibody in ascetic fluid followed by celiacly injecting the mouse with S180 cells. The mouse anti-rat RVLG antibody was analyzed by ELISA, Western blotting and immunohistochemistry for its specificity and titer. The antibody could recognize RVLG protein specifically and its titer was about 1:20 000. These results confirm that the mouse anti-rat RVLG polyclonal antibody with high affinity and specificity has been prepared successfully, and lay a foundation for our ongoing research on the specific expression of RVLG in rat ovary.
Animals ; Antibodies, Monoclonal ; biosynthesis ; Base Sequence ; Cloning, Molecular ; DEAD-box RNA Helicases ; biosynthesis ; genetics ; immunology ; DNA, Complementary ; biosynthesis ; genetics ; Escherichia coli ; genetics ; metabolism ; Female ; Mice ; Molecular Sequence Data ; Ovary ; cytology ; metabolism ; RNA, Messenger ; biosynthesis ; genetics ; Rats ; Recombinant Fusion Proteins ; biosynthesis ; genetics ; immunology

Objective: To investigate the therapeutic effects of compound Kushen Tang and its relevant mechanism in TNBS-in-duced ulcerative colitis ( UC) rats. Methods:UC was induced by TNBS in rats. After compound Kushen Tang was given orally, the levels of MDA, iNOS, and NO and the activity of MPO, SOD, and GSH-Px were measured. The general condition of rats and colon tissue morphology were observed. Results:The levels of MDA (P<0. 05), iNOS (P<0. 01) and NO (P<0. 01) and the activity of MPO (P<0. 01) in tissues of UC rats were significantly higher than the control group. The activity of SOD (P<0. 01) and GSH-Px (P<0. 05) were significantly lower than those in the control group. After the treatment with high doses of compound Kushen Tang, the levels of MPO (P<0. 01), MDA (P<0. 05), iNOS (P<0. 05) and NO (P<0. 01) were significantly decreased, and the activity of SOD (P<0. 01) and GSH-Px (P<0. 05) significantly increased. The therapeutic effect was dose-dependent and the general con-dition of rats and colon tissue morphology were also significantly improved. Conclusion:Compound Kushen Tang is considered as a no-vel therapeutic alternatives for the treatment of UC, which can reduce coloni inflammatory injury and ameliorate the colitis.

Objective To investigate the potential active ingredients and the mechanism of Coreopsis tinctoria Nutt. in the prevention and treatment of hyperlipidemia. Methods Ultra-high performance liquid chromatography-Quadrupole-Exactive Orbitrap mass spectrometry (UPLC-Q-Exactive Orbitrap MS) was used to qualitatively analyze the fractions and blood components of flavones in Coreopsis tinctoria Nutt. The intersection targets of flavones in Coreopsis tinctoria Nutt. and hyperlipidemia were screened,and the protein-protein interaction network was constructed and analyzed by the STRING 12.0 database. Finally,the gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used for enrichment analysis. Results A total of 25 compounds were detected from the flavones in Coreopsis tinctoria Nutt.,and their structures were identified,including ten chalcones,nine flavanones,four flavonols,one aurone,and one biflavone. The analysis of blood components showed that marein,flavanomarein,okanin,isookanin and 5,7,3',5'-tetrahydroxyflavanone-7-O-β-D-glucopyranoside were the main components of the flavones in Coreopsis tinctoria Nutt. in blood. Network pharmacological GO and KEGG enrichment analysis showed that the flavones in Coreopsis tinctoria Nutt. may regulate phosphatidylinositol 3-kinase/protein kinase B,tumor necrosis factor,hypoxia-inducible factor-1 signaling pathway and other signaling pathways in the regulation and prevention of hyperlipidemia. Conclusion Coreopsis tinctoria Nutt. can prevent and treat hyperlipidemia,and the mechanism may be related to the five blood components of the flavones in Coreopsis tinctoria Nutt.,including marein,flavanomarein,okanin,isookanin and 5,7,3',5'-tetrahydroxyflavanone-7-O-β-D-glucopyranoside.

Objective:To explore the RH genotype for a female with RhD(-) blood type and its molecular basis. Methods:A 26-year-old female who had attended the outpatient clinic of the First Affiliated Hospital of Zhengzhou University in August 2019 was selected as the study subject. Peripheral blood samples were collected from the proband and her parents for Rh phenotyping with gel card method. PCR-sequence-based typing (PCR-SBT) and DNA sequencing were used to determine the RHD zygosity and RH genotype of the proband and her parents. Homology modeling of Rh proteins was performed with bioinformatic software, and protein structural alterations caused by the variant was simulated by molecular dynamics. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Ethics No. 2023-KY-0870-003). Results:Serological tests showed that the proband and her father both had weakened e antigen of the Rh phenotype. PCR-SBT and DNA sequencing showed that the genotypes of the proband and her parents were dce/ dCE, dce/ DcE and dCE/ DcE, respectively. And the genotypes of the RHD and RHCE of the proband were RHD*01N.01/ RHD*01N.16, RHCE*01.01/RHCE*04, respectively. Protein simulation and molecular dynamics analysis revealed that the ce_16C variant resulted from RHCE* ce (c.48G>C) may alter the structure of intracellular and extracellular loops, mainly affecting the mobility of extracellular loops 2, 6 and intracellular loops 3, 4. Conclusion:Variant of the RHCE* ce allele c. 48G>C probably underlay the weakened e antigen in this proband.