Objective To summarize the analytical results of radioactivity in the food and drinking water nationwide following the Fukushima nuclear accident,and to evaluate its possible contamination to the public health in China.Methods According to the national standard methods and IAEA,FDA correlative references,the scheme was established on sampling and measurements in food and drinking water after the breakout of the accident.The quality control was requested on the sampling,analyses and data report.Results Trace artificial radioactive isotope of 131I was measured in spinach samples on 2 April 2011 in Beijing. Subsequently 131I was found in 10 kinds of growing leaves vegetables (open field)nationwide.The maximum detectable activity of 131I in vegetables was about 3.1 Bq/kg.Since 3 May 2011,the concentration of 131I has been below the detection limits.No artificial radionulide was detectable in all of milk,drinking water and marine products samples during March to December,2011.Conclusions The food and drinking water measurements in China following the Fukushima nuclear accident denoted that the minor amounts of 131I in vegetables might result in very low absorbed dose and induce no impact on human health.The maximum detectable activity of 131I in vegetables was close to that reported in European countries,and much less than that measured in China immediately after the Chernobyl accident in 1986.

Adult ; Aortic Valve ; microbiology ; pathology ; Autopsy ; Brain ; microbiology ; pathology ; Endocarditis, Bacterial ; complications ; microbiology ; pathology ; Female ; Heart Ventricles ; microbiology ; pathology ; Humans ; Mitral Valve ; pathology ; Sepsis ; complications ; microbiology ; pathology ; Substance Abuse, Intravenous ; complications ; microbiology ; pathology ; Young Adult

Objective To ascertain the concentrations of uranium in drinking water around nuclear power plants.Methods A total of 106 water samples were collected from June 2009 to March 2010 in Jiangsu,Zhejiang,Liaoning and Shandong provinces.Inductively coupled plasma-msgs spectrometry(ICPMS)was applied to determine uranium content in local water source and drinking water.The detection limit of U was 0.8 ng/L.The recovery was 100.9%.Results The uranium concentrations in all samples were less than 15μg/L which was the limit given by World Health Organization(WHO).Conclusions The concentration of uranium in water sources was as follows:Liaoning>Shandong>Jiangsu>Zhejiang.The concentration of uranium in drinking water W88 maximal in Shandong Province and minimal in Zhejiang Province.

Objective To observe the changes of immunological parameters and the effects of intravenous immunoglobulin (IVIG) in children with idiopathic thrombocytopenic purpura (ITP),schonlein-Henoch purpura(HSP) and mucocutaneoas lymph node syn-drome(kawasaki disease, KD).Methods T cell subsets and serum immunoglobulins and complements were measured with the flow cytometry and enhanced trubidimetric immunoassay. Routine therapy combined with IVIG. Results CD3+ CD4+ T cells were de-creased in children with ITP accompanied by increased serum IgG;Serum IgA and CD3+ T cells were increased in children with HSP; CD3+ CD8+ T cells were decreased in children with KD. Clinical features were markedly improved after treatment with IVIG. It was noted that the incidence of damage to coronary artery decreased after the use of IVIG. Conclusions T cell subsets, serum immunoglobulins should undergo the clinical routine examinations in ITP,HSP and KD. Early administration of IVIG might be important to improve disease prognosis and shorten its course of treatment in children with three kinds of immunology related diseases.

Objective: To explore the clinical features and pregnancy outcomes of intrauterine subchorionic hematoma and retroplacental hematoma. Methods: From May 2016 to May 2018, in the Fourth Hospital of Xi′an City, 110 cases of intrauterine hematoma were selected in the middle of pregnancy, including 52 cases of subchorionic hemaloma (group A) and 58 cases of retroplacental hematoma (group B). The clinical features and pregnancy outcomes of the two groups were compared. Results: The volume of hematoma in group B was significantly smaller than that in group A [(8.8 ± 1.7) cm³ vs. (18.3 ± 2.0) cm³], the gestational weeks of group B was also significantly lower than that of group A [(35.2 ± 2.1) weeks vs. (38.4 ± 1.8) weeks], the full-term pregnancy rate in group B was lower than that in group A[56.9%(33/58) vs. 84.6%(44/52)], miscarriage rate and premature birth rate were higher than those in group A [20.7%(12/58) vs. 5.8%(3/52), 22.4%(13/58) vs. 7.7%(4/52)], and the differences were statistically significant (P < 0.05).The incidence of fetal distress in group B was higher than that in group A [17.4%(8/46) vs. 2.0%(1/49)], the incidence of fetal membrane rupture, placental abnormality, and placental residue was all higher than that in group A[41.3%(19/46) vs.10.2%(5/49), 37.0%(17/46)vs.12.2%(6/49), 28.3%(13/46) vs. 6.1%(3/49)], and the differences were statistically significant (P < 0.05). The neonatal body mass in group B was lower than that in group A [(3 091.7 ± 887.6) g vs. (3 457.6 ± 560.2) g], and the incidence of neonatal diseases was higher than that of group A [15.2%(7/46) vs. 2.0%(1/49)], and the differences were statistically significant (P < 0.05). Conclusions The volume of hematoma and gestational weeks of intrauterine retroplacental hematoma are lower than those of subchorionic hematoma, and the retroplacental hematoma is more likely to have adverse pregnancy outcomes.

ObjectiveTo analyze the effect of temporal distance parameters on comfortable and maximal walking speed of hemiplegic stroke patients.MethodsThe comfortable and maximal walking speed of 85 hemiplegic stroke patients were tested by 10 m walking speed and temporal distance parameters of gait cycle were obtained. The effect of step length and walking rate on comfortable and maximal walking speed was analyzed.ResultsStep length and walking rate were significantly positive related to comfortable and maximal walking speed (r=0.849-0.915,P<0.001).The step regression analysis selected step length as a significant variable for comfortable and maximal walking speed (R2=0.835,R2=0.827,respectively). ConclusionThe important parameter that influences comfortable and maximal walking speed of hemiplegic stroke patients is step length.

ObjectiveTo explore the characteristics and rehabilitation of dysarthria patients who speak mandarin. Methods18 patients were rehabilitated with physiologic approach for 40 d. Before and after rehabilitation, maximum phonation time (MPT), frequency, tone and expiratory rate were tested with phonolaryngeal graph, while forced vital capacity (FVC), forced expiratory volume in one second (FEV1), maximum midexpiratory flow (MMF), peak expiratory flow rate (PEFR) were tested with Microspiro; Articulation and intelligibility were tested with mandarin words table and rate of sentence and paragraph. ResultsCompared with that before intervention, MPT of the patients were longer after intervention (P<0.05). The FVC was lower than normal rate before intervention and it was remarkable higher after intervention(P<0.01).Correct rate of sentence and paragraph was remarkable higher(P<0.01). ConclusionTests of Phono-laryngograph, Microspiro and correct rate of sentence are good comprehensive evaluation methods to speech and phonation of dysarthria. Physiologic approach to rehabilitation can remarkably improve patient's communication ability.

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

OBJECTIVETo evaluate the effect of intrajejunal nutrition on uptake of amino acid and enzyme-protein synthesis in pancreatic acinar cell and subcellular fractionation and zymogen granules in dogs with acute pancreatitis.

METHODSFifteen dogs were induced acute pancreatitis by retrograde injection of 5% sodium-taurocholate into the pancreatic duct. Radioactive tracing and electron microscope were used to evaluate the change of amino acid uptake, enzyme-protein synthesis in acinar cell, subcellular fractionation, the quantitative analysis of mean zymogen granule number and mean zymogen granule area after injection L-(3)H-phenylalanine 30, 60, 120 1nd 180 min on the 7(th) day.

RESULTSThe radioactivity of L-(3)H phenylalanine uptake by pancreatic acinar cells and incorporations of L-(3)H phenylalanine into newly synthesized enzyme-protein peaked at 60 min. In enteral nutrition (EN) group it was higher that that in parenteral nutrition (PN) group (P < 0.05), and then gradually declined. The radioactivity peaked at 60 min in zymogen granule, lysosomal-mitochondria and microsomal subcellular fractionation. The latter two decreased, bat there was no significant difference (P > 0.05). The change of the mean number and mean area of zymogen granules were not significant different between the EN group and PN group (P > 0.05).

CONCLUSIONEN or PN do not stimulate pancreatic acinar uptake amino acid and enzyme-protein synthesis in acinar cell and subcellular fractionation.

Acute Disease ; Amino Acids ; metabolism ; Animals ; Disease Models, Animal ; Dogs ; Enteral Nutrition ; Enzyme Precursors ; biosynthesis ; Female ; Male ; Pancreas, Exocrine ; metabolism ; Pancreatitis ; pathology ; physiopathology ; therapy ; Parenteral Nutrition ; Random Allocation ; Treatment Outcome

In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.
Alleles ; Asian Continental Ancestry Group ; genetics ; Blood Donors ; Blood Group Antigens ; genetics ; Cell Adhesion Molecules ; genetics ; Exons ; genetics ; Homozygote ; Humans ; Polymorphism, Genetic ; Sequence Analysis, DNA