1.Clinical and pathological characteristics of adolescent-onset primary nephrotic syndrome in 110 children in a single center
Sanlong ZHAO ; Hongmei WU ; Fei ZHAO ; Yuan HAN ; Chunhua ZHU ; Xueqin CHENG ; Qiuxia CHEN ; Songming HUANG
Chinese Journal of Nephrology 2023;39(10):738-744
Objective:To analyze the clinical and pathological features of adolescent- onset primary nephrotic syndrome (PNS) in children (10 years≤age≤18 years), so as to explore the renal biopsy indications in adolescent-onset PNS.Methods:It was a single-center retrospective observational study. The clinical and pathological data of adolescent-onset PNS (age≥10 years) who underwent renal biopsy in Children's Hospital Affiliated to Nanjing Medical University from December 2004 to June 2022 were analyzed retrospectively.Results:A total of 110 children were included in the study, including 76 males (69.1%) and 34 females (30.9%), with the onset age ranging from 10 years to 14 years and 9 months. Forty-nine cases (44.5%) were accompanied by hematuria, including 14 cases (12.7%) of gross hematuria and 35 cases (31.8%) of microscopic hematuria. Twenty-five cases (22.7%) had hypertension, 19 cases (17.3%) had renal insufficiency, and 4 cases (3.6%) had low complement C3 at the onset. Fifty-two cases (47.3%) were steroid sensitive nephrotic syndrome and 58 cases (52.7%) were steroid resistant nephrotic syndrome. Biopsy results showed that minimal change disease(MCD) was the most common histopathological subtype (47.3%, 52 case), followed by focal segmental glomerulosclerosis (FSGS) in 22 cases (20.0%), IgA nephropathy (IgAN) in 17 cases (15.5%), membranous nephropathy (MN) in 7 cases (6.4%), mesangial proliferative glomerulonephritis in 5 cases (4.5%), IgM nephropathy in 4 cases (3.6%), membranous proliferative glomerulonephritis in 2 cases (1.8%), and C1q nephropathy in 1 case (0.9%). Among 44 children with simple type nephrotic syndrome, the pathological type was mainly MCD (77.3%), and 66 children with nephritic type nephrotic syndrome were mostly non-MCD (72.7%), such as IgAN, FSGS, MN, etc. If there are two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency or low C3 levels, the proportion of non-MCD would further increase to 92.0%(23/25). The pathological type of patient with gross hematuria or low C3-emia was non-MCD. The frequency of hematuria (69.0% vs. 17.3%, χ2=29.619, P<0.001), hypertension (31.0% vs. 13.5%, χ2=4.821, P=0.028) and renal insufficiency (24.1% vs. 9.6%, χ2=4.047, P=0.044) in non-MCD group was significantly higher than those in MCD group. Conclusions:If the clinical manifestation of PNS in adolescent over 10 years old is simple type nephrotic syndrome, the histopathological lesion is mostly MCD, and most of them are steroid sensitive. It is recommended to give hormone treatment first, and then perform renal biopsy if steroid resistance occurs; If the clinical manifestation is nephritic type nephrotic syndrome, the histopathological lesion is mostly non-MCD, especially those with gross hematuria or low C3-emia, or those have two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency and hypocomplement C3-emia, a kidney biopsy should be performed at onset.
2.Clinical analysis of antineutrophil cytoplasmic antibody-associated vasculitis in 13 children
Sanlong ZHAO ; Hongmei WU ; Fei ZHAO ; Guixia DING ; Chunhua ZHU ; Xueqin CHENG ; Qiuxia CHEN ; Songming HUANG
Chinese Journal of Nephrology 2022;38(8):664-671
Objective:To investigate the clinical manifestations, pathological characteristics, treatment and prognosis of anti-neutrophil cytoplasmic antibody-associated vasculitis (AAV) in 13 children.Methods:The clinical and pathological data of 13 cases of AAV in children′s Hospital of Nanjing Medical University from June 2000 to December 2021 were retrospectively analyzed.Results:Among the 13 cases, 12 cases were diagnosed with microscopic polyangiitis (MPA) and 1 case was granulomatosis with polyangiitis (GPA), including 10 females and 3 males. The onset age ranged from 3 years and 11 months to 13 years and 10 months. The most frequently involved organ was the kidney (12 cases, 92.3%), followed by respiratory system (7 cases, 53.8%), skin (5 cases, 38.5%), digestive system (4 cases, 30.8%), nervous system (4 cases, 30.8%) and cardiovascular system (3 cases, 23.1%). There were 10 cases with orthotic anemia, 7 cases with positive antinuclear antibody, and 3 cases with mildly decreased complement C3. Among the 12 children with renal impairment, 9 cases were accompanied by abnormal renal function at the beginning of the disease. Renal biopsy was classified according to the Berden as follows: sclerotic in 5 cases, crescentic 3 cases, focal in 2 cases and mixed in 2 cases. All children were treated with glucocorticoid combined with immunosuppressant. During the follow-up time from 8 months to 128 months, 4 cases acquired complete remission, 8 cases achieved partial remission and 1 case recurred after complete remission, and 7 cases progressed to chronic kidney disease stage 5. Three children with complete remission underwent repeated renal biopsy, including 2 cases of mixed type and 1 case of crescent type initially, and all changed to focal type.Conclusions:AAV in children occurs mainly in school-age female, and most of AAV in children is MPA. The clinical manifestations are various. Most of them have renal damage and anemia, and lung damage is also common. Patients with skin purpura onset may be misdiagnosed as Henoch-Schonlein purpura, and AAV with ANA positive or complement reduction should exclude systemic lupus erythematosus. Once the renal function is abnormal in AAV, especially estimated glomerular filtration rate<60 ml·min -1·(1.73 m 2) -1 and the pathological classification is sclerotic type or crescent type, it is difficult to reverse even after active treatment. Early diagnosis and treatment are very important for AAV.
3.Advances of retinoic acid-inducible gene I in kidney diseases
Peihua ZHENG ; Jing YU ; Songming HUANG
International Journal of Pediatrics 2021;48(12):843-846
Retinoic acid-inducible gene I is an important intracellular pattern recognition receptor in antiviral innate immune responses.After recognition of viral RNA, retinoic acid-inducible gene I triggers antiviral signaling pathways which induce the production of interferons and proinflammatory cytokines.Kidney is an important organ of human body.The occurrence of kidney diseases in childhood has a great impact on children's growth and daily life.Recent studies have shown that retinoic acid-inducible gene I can participate in inflammation and immune responses of kidney, and promote the occurrence and progression of kidney diseases.This article reviews the research progress of retinoic acid-inducible gene I in kidney diseases, and discusses its application prospect as a biomarker and therapeutic target of kidney diseases.
4.CLinicaL features and MYH9 gene variant in two Chinese sibLings with Fechtner syndrome
SanLong ZHAO ; Fei ZHAO ; Aihua ZHANG ; Songming HUANG
Chinese Journal of Pediatrics 2019;57(4):286-290
Objective To summarize the cLinicaL data and moLecuLar characteristics of two sibLings with Fechtner syndrome. Methods A retrospective anaLysis was made on the cLinicaL data, Laboratory tests and genetic test resuLts of two sibLings with Fechtner syndrome in a famiLy who were foLLowed up in the Department of NephroLogy, ChiLdren′s HospitaL AffiLiated to Nanjing MedicaL University from ApriL 2018 to August 2018. ResuLts Both sibLings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant pLateLets and Leucocyte incLusions were easiLy seen in peripheraL bLood smears and bone marrow ceLLs, but the resuLts of renaL function, hearing and ophthaLmoLogic examinations were normaL. The father of the sibLings presented with proteinuria, thrombocytopenia, and hearing Loss. At the age of 26 years, he deveLoped uremia and now requires hemodiaLysis. The renaL biopsy of the eLder sister suggested focaL segmentaL gLomeruLoscLerosis. Gene anaLysis showed that the sibLings and their father MYH9 gene 25 exon c. 3195_c. 3215 deLCGAGCTCCAGCCCAGATCGC (p. A1065_A1072 deL) deLetion mutation. The eLder sister was treated with benazepriL hydrochLoride for 4 months and the proteinuria was improved. Her younger brother was given tacroLimus for 3 months, but the proteinuria did not improve significantLy, then benazepriL hydrochLoride was given for 1 month and proteinuria improved. ConcLusions Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant pLateLets and Leucocyte incLusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deLetion mutation of p.A1065_A1072deL is the second internationaL report. Angiotensin?converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.
5. A multicenter study of reference intervals for 15 laboratory parameters in Chinese children
Xuhui ZHONG ; Jie DING ; Jianhua ZHOU ; Zihua YU ; Shuzhen SUN ; Ying BAO ; Jianhua MAO ; Li YU ; Zhihui LI ; Ziming HAN ; Hongmei SONG ; Xiaoyun JIANG ; Yuling LIU ; Bili ZHANG ; Zhengkun XIA ; Chunhua JIN ; Guanghua ZHU ; Mo WANG ; Shipin FENG ; Ying SHEN ; Songming HUANG ; Qingshan MA ; Haixia LI ; Xuejing WANG ; Kiyoshi ICHIHARA ; Chen YAO ; Chongya DONG
Chinese Journal of Pediatrics 2018;56(11):835-845
Objective:
To establish comprehensive laboratory reference intervals for Chinese children.
Methods:
This was a cross-sectional multicenter study. From June 2013 to December 2014, eligible healthy children aged from 6-month to 17-year were enrolled from 20 medical centers with informed consent. They were assessed by physical examination, questionnaire survey and abdominal ultrasound for eligibility. Fasting blood samples were collected and delivered to central laboratory. Measurements of 15 clinical laboratory parameters were performed, including estradiol (E2), testosterone(T), luteinizing hormone(LH), follicle-stimulating hormone(FSH), alanine transaminase(ALT), serum creatinine(Scr), cystatin C, immunoglobulin A(IgA), immunoglobulin G(IgG), immunoglobulin M(IgM), complement (C3, C4), alkaline phosphatase(ALP), uric acid(UA) and creatine kinase(CK). Reference intervals were established according to central 95% confidence intervals for reference population, stratified by age and sex.
Results:
In total, 2 259 children were enrolled. Finally, 1 648 children were eligible for this study, including 830 boys and 818 girls, at a mean age of 7.4 years. Age- and sex- specific reference intervals have been established for the parameters. Reference intervals of sex hormones increased gradually with age. Concentrations of ALT, cystatin C, ALP and CK were higher in children under 2 years old. Serum levels of sex hormones, creatinine, immunoglobin, CK, ALP and urea increased rapidly in adolescence, with significant sex difference. In addition, reference intervals were variable depending on assay methods. Concentrations of ALT detected by reagents with pyridoxal 5'-phosphate(PLP) were higher than those detected by reagents without PLP. Compared with enzymatic method, Jaffe assay always got higher results of serum creatinine, especially in children younger than 9 years old.
Conclusion
This study established age- and sex- specific reference intervals, for 15 clinical laboratory parameters based on defined healthy children.
6. Clinical features and genetic variants of Dent disease in 10 children
Sanlong ZHAO ; Fei ZHAO ; Yugen SHA ; Qiuxia CHEN ; Xueqin CHENG ; Songming HUANG
Chinese Journal of Pediatrics 2018;56(4):289-293
Objective:
To summarize the clinical features and genetic analysis results of 10 children with Dent disease.
Methods:
The clinical data and gene test results of 10 boys aged from 8 months to 12 years with Dent disease diagnosed in Children's Hospital of Nanjing Medical University from January 2014 to July 2017 were analyzed retrospectively.
Results:
All patients had insidious onset, 5 cases were found to have proteinuria on routine urine examination after hospitalization duo to other diseases, 4 cases were admitted to hospital because increased foams in the urine, and 1 case was found to have proteinuria on health checkup. All cases presented with low molecular weight proteinuria, urine protein electrophoresis showed that the proportion of low molecular weight protein was greater than 50%, 7 cases had nephrotic-range proteinuria, but none had hypoproteinemia. Six cases had hypercalciuria, 3 cases had nephrocalcinosis, 1 case had nephrolithiasis, 2 cases had glomerular microscopic hematuria, in 1 case urine glucose wa weakly positive but blood glucose was normal. All patients had normal renal function, normal serum calcium, no hypophosphoremia and none had rickets. Genetic analysis results showed that 7 patients with variants in the CLCN5 gene, including 2 nonsense variants (p.R637X, p.Y143X), 3 missense variants (p.A540D, p.G135E, p.G703V), 1 deletion variant (exons 9, 10, 11, 12, 13, 1 missing), and 1 frameshift variant (p.T260Tfs*10). Three cases had missense variants of OCRL gene (p.I274T, p.I371T, p.F399S). Except for p.R637X and p.I274T, the other 8 cases had newly discovered variants. Five patients underwent a renal biopsy, the biopsy revealed focal global glomerulosclerosis in 3 patients, mild mesangial proliferative glomerulonephritis in 1 patient and renal minimal change in 1 patient. Mild focal tubular atrophy and interstitial fibrosis were noted in three cases. Mild segmental foot process effacement was noted under electron microscope in all five cases.
Conclusions
All the children with Dent disease had insidious onset, low molecular weight proteinuria is the main clinical manifestation, most cases presented with nephrotic-range proteinuria, but there was no hypoalbuminemia, some cases were not associated with hypercalciuria. The pathogenic genes in most cases were CLCN5 and a few were OCRL. The types of genetic variation include missense variant, nonsense variant, deletion variant and frameshift variant. Although Dent disease is a renal tubular disease, renal biopsy suggests that most cases are associated with glomerular lesions.
7.Clinicopathological features and prognosis of minimal change nephropathy with IgA deposition in children
Sanlong ZHAO ; Fei ZHAO ; Chunhua ZHU ; Guixia DING ; Songming HUANG
Chinese Journal of Applied Clinical Pediatrics 2018;33(5):353-357
Objective To analyze the clinicopathological features and prognosis of minimal change nephropa-thy with IgA deposition(MCD-IgA)in children.Methods The clinical and pathological data of 10 cases in Chil-dren's Hospital of Nanjing Medical University from January 2010 to December 2015 with MCD-IgA were retrospective-ly analyzed,and 24 cases of minimal change nephrotic syndrome(MCD-NS)and 21 cases of IgA nephropathy clini-cally manifested with nephrotic syndrome(NS-IgAN)were selected as controls.Results (1)Clinical manifesta-tions:there were no significant differences in age,gender,incidence of hematuria,level of 24 hours urine protein,serum albumin and cholesterol levels and elevated serum IgA ratio in MCD-IgA compared with MCD-NS group.Compared with MCD-IgA and MCD-NS,NS -IgAN group showed older age of onset[(8.6 ± 2.1)years vs.(4.8 ± 2.4) years,(4.0 ± 1.6)years],higher level of serum albumin[(22.8 ± 4.3)g/L vs.(19.0 ± 1.9)g/L,(16.8 ± 3.0) g/L],and lower level of serum total cholesterol[(7.9 ± 1.9)mmol/L vs.(9.9 ± 2.7)mmol/L,(9.8 ± 2.1)mmol/L], and all the differences were significant(all P<0.05).NS-IgAN group was all associated with gross hematuria.(2) Pathology:the light microscope lesions in MCD-IgA and MCD-NS group were mild,but it was usually associated with severe histologic lesions in NS-IgAN,such as endocapillary proliferation,segmental sclerosis,crescent formation,tuft necrosis and chronic tubulointerstitial lesions;in MCD -NS group,immunofluorescence was negative. In MCD -IgA group,IgA deposition intensity was weak(less than + +),and 3 cases(30.0%)were accompanied with C3deposi-tion.In NS-IgAN group,IgA deposition intensity was stronger(more than + + +),and most of the cases were accom-panied with C3and other immunoglobulins deposition.Under electron microscope,both MCD-IgA and MCD-NS showed wide foot process effacement,and a small amount of mesangial electron dense deposit was detected in 9 cases of MCD-IgA.In NS-IgAN group,large amount of electron dense deposit was found in the mesangial region,and only 8 cases (38.0%)showed more than 50% of foot process effacement.(3)Prognosis:in MCD-IgA group,9 patients were ster-oid-dependent or frequently relapsed,1 case showed steroid-resistance,6 patients required additional agents.Except 1 case lost,with an average of(61.5 ± 28.8)months were followed up,8 patients achieved complete remission;In MCD-NS group,20 cases were steroid-dependent or frequently relapsed,4 cases were steroid-resistant,23 cases re-quired additional immunosuppressive agents.Followed up for an average of(36.4 ± 12.5)months,22 cases(91.7%) achieved complete remission;In NS-IgAN group,all cases were steroid-resistant and combined with cyclophospha-mide treatment;followed up for an average of(38.6 ± 15.2)months,19 cases(90.5%)achieved complete remission. Conclusions The clinical manifestations and prognosis of MCD-IgA were similar to MCD-NS,but the clinical and pathological findings of MCD-IgA were different from those of NS-IgAN.It is deduced that the nature of MCD-IgA is still a MCD,and that the IgA deposition may be nonspecific.
8.Effect of inhaled corticosteroids guided by GLCCI1 gene detection on treatment of patients with asthma
Xingqiao WANG ; Qin YIN ; Tianqi WANG ; Wen HUANG ; Songming LI
Journal of Clinical Medicine in Practice 2017;21(1):34-36
Objective To explore the clinical value of GLCCI1 gene detection in guiding administration of inhaled corticosteroids in patients with asthma.Methods Eighty asthma patients were divided into wild type allele group (n =64) and mutant type allele group (n =16) according to GLCCI1 gene detection.Both groups were treated with budesonide aerosol,and the clinical effect was compared between two groups.Results In wild type allele group,the total effective rate was 92.2% and the incidence rate of adverse reaction was 7.8%,which were significantly better than 75.0% and 25.0% in mutant type allele group (P < 0.05).There were significant differences in FEV1,FEV/FVC ratio,FVC and PEF between two groups (P < 0.05).Conclusion The GLCCI1 gene detectiou can significantly improve the effect of inhaled corticosteroids and reduce the incidence rate of adverse reactions.
9.Effect of inhaled corticosteroids guided by GLCCI1 gene detection on treatment of patients with asthma
Xingqiao WANG ; Qin YIN ; Tianqi WANG ; Wen HUANG ; Songming LI
Journal of Clinical Medicine in Practice 2017;21(1):34-36
Objective To explore the clinical value of GLCCI1 gene detection in guiding administration of inhaled corticosteroids in patients with asthma.Methods Eighty asthma patients were divided into wild type allele group (n =64) and mutant type allele group (n =16) according to GLCCI1 gene detection.Both groups were treated with budesonide aerosol,and the clinical effect was compared between two groups.Results In wild type allele group,the total effective rate was 92.2% and the incidence rate of adverse reaction was 7.8%,which were significantly better than 75.0% and 25.0% in mutant type allele group (P < 0.05).There were significant differences in FEV1,FEV/FVC ratio,FVC and PEF between two groups (P < 0.05).Conclusion The GLCCI1 gene detectiou can significantly improve the effect of inhaled corticosteroids and reduce the incidence rate of adverse reactions.
10.Common complication of central venous catheter for pediatric blood purification
Chinese Journal of Applied Clinical Pediatrics 2016;31(17):1281-1285
Pediatric blood purification requires reliable access to the circulation.Central venous catheters play an important role in the delivery of pediatric blood purification.A central venous noncuffed,nontunneled catheter is the best choice for short-term(less than 3 weeks) blood purification.A cuffed,tunneled catheter is preferable to long term(more than 3 weeks) blood purification.However,there are many complications associated with central venous catheters,such as catheter-induced thrombosis,catheter-related infection,and central vein stenosis.This article reviews the prevention and treatment of complications most frequently occurring with central venous catheters.

Result Analysis
Print
Save
E-mail