Objective To investigate the relationship between serum uric acid level in multiple sclerosis(MS) and the clinical activity of disease.Methods The serum levels of uric acid in 88 MS patients(48 females and 40 males) were measured and compared with the patients of other imflammatory neurological disease(OIND) and healthy donors.The relationships between serum uric acid level and clinical stage,course of disease and patient's condition were analyzed.Results MS patients had significantly lower serum uric acid levels in comparison with OIND patients and healthy donors(all(P)0.05).Conclusion Serum uric acid level may be served as a auxiliary marker in diagnosing MS and judging its stage.

Objective To summarize the clinical characteristics of myotonic dystrophy(DM).Methods The clinical data of 24 DM cases were analyzed retrospectively.Results 83.3%(20/24) of the patients obtained the disease during youth and it progressed slowly.79.2%(19/24) of the patients had positive family history.DM was a multisystem disease characterizing by myotonia,weakness and atrophy involved in multiple muscle groups,especially in distal limbs,neck and face.Extensors were more severe than flexors.Spontaneous myotonic discharges and myogenic damages were shown on electromyogram.Pathological examination of muscle biopsies showed increased number of central nuclei,nuclear chains and predominant atrophic typeⅠfibers in 8 cases,muscle fiber necrosis in 7 cases,fibrous structure disorder in 4 cases,sarcoplasmic masses in 3 cases,and serration of sarolemma in 2 cases.Conclusions The clinical characteristics of DM are weakness,atrophy and myotonia.Electromyogram and muscle biopsy are helpful in diagnosis of this disease.

Objective To study the expression of normal and variant ATP7B proteins, in order to further find the mechanism of Wilson disease. Methods Normal ATP7BcDNA/pcDNA3 was made and mutant variants Arg778Leu/pcDNA3, Gln914Ter/pcDNA3 and Thr935Met/pcDNA3 were constructed by using Quik-Change TM Site-directed Mutagenesis Kit in vitro. A good quality rabbit polyclonal antibody against the N-terminal functional domains of ATP7B was produced and purified, being named rabbit anti-human ATP7Bn33-629 polyclonal antibody. Normal and variant expression plasmids constructed above were transfected into Chinese hamster ovary (CHO) cells. After a 36-hour incubation at 37℃, the transfected CHO cells were collected. Expression of normal and variant ATP7B protein were detected and compared by Western blot analysis of cell lysates using ATP7Bn33-629 antibody. Results Expression of ATP7B normal protein in transfected CHO cells was the same as that of ATP7B variant proteins Arg778Leu and Thr935Met.Gln914Ter variant shortened ATP7B protein to 100 kd and increased the level of expression. Conclusion The mechanism under disorder of copper transport caused by the missense mutations should be not related to the level of expression. The increased level of expression caused by Gln914Ter might be associated with the shortened ATP7B protein that needs less time for translation.

Objective To investigate the MRI features of progressiv e mu scular dystrophy (PMD), and evaluate the diagnostic value of MRI for PMD. Methods Thirty-three biopsy-proved PMD patients underwent MRI of face, scapular, thigh, and leg, including 16 cases of Duchenne muscular dystrophy (DMD), 2 cases of Beck er′s muscular dystrophy, 5 cases of limb-girdle muscular dystrophy, and 10 c ases o f facioscapulohumeral muscular dystrophy. Spin echo sequence, fast spin echo seq uence, and STIR sequence were utilized. Results The signal inte nsity of disease d muscle with DMD, limb-girdle muscular dystrophy, and Becker′s muscular dystr op hy was hyperintense on both T_1-weighted images(T_1WI) and T_2-weighted ima ges (T_2WI). Gracilis muscle of 21 cases, sartorius muscle of 19 cases, semiten dinosus mus cle of 19 cases, and tibialis posterior muscle of 20 cases were relatively spare d. Ten cases with facioscapulohumeral muscular dystrophy displayed two kinds of a bnormal signals: hyperintense on T_2WI and hypointense on T_1WI in all 10 ca ses;hyperintense on both T_2WI and T_1WI in 7 cases. Conclusion The MRI findings in PMD show certain characteri stics: (1)the involved muscles are mainly replaced by fat. (2)On the lower extre mi ty, Gracilis muscle, sartorius muscle, semitendinosus muscle, and tibialis poste rior muscle were relatively spared in DMD, limb-girdle muscular dystrophy, and B ecker′ muscular dystrophy.(3) Facioscapulohumeral muscular dystrophy displays t wo kinds of abnormal signals which represent fat replacement and inflammatory edem a lesion. MRI can provide objective data for clinical diagnosis, therapeutic eva luation, and follow-up. It can also help to decide the accurate localizations f or biopsies.

Objective To study the clinical and genetic features of familial paroxysmal kinesigenic dyskinesias (PKD). Methods The clinical information of PKD patients from 3 Han families was analyzed and the pedigrees were further investigated. Results There were 25 PKD cases in 3 families, including 16 males and 9 females. The onset age ranged from 1 to 10 years. The attacks were provoked by voluntary movements and each attack lasted less than 30 seconds with no loss of consciousness. No neurological signs and abnormal examination were detected during the intermittent period. There were 10 to 50 attacks per day, but the frequency commonly decreased with the increase of age. The attacks can be controlled by carbamazepine. The disease was inherited in an autosomal dominant mode. Males were affected more severely than females. Conclusions The main inheritance mode of familial PKD is autosomal dominant. There may be clinic or genetic heterogeneity.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.