1.Ameliorative effect and mechanism of Sanwei ganlu on hepatic fibrosis in rats
Xiumei CHEN ; Yingjie WANG ; Chengzhou ZHAO ; Zhen LI ; Wenhuiping ZHANG ; Tangjun LUO ; Xin LIU ; Shengnan SUN
China Pharmacy 2024;35(6):707-711
OBJECTIVE To investigate the ameliorative effects and mechanism of Sanwei ganlu on hepatic fibrosis in rats. METHODS The rats were randomly divided into normal group, model group, silibinin group (positive control, 50 mg/kg), and Sanwei ganlu low-dose, medium-dose, and high-dose groups (80, 250, 800 mg/kg). Except for normal group, hepatic fibrosis rat models were established by intraperitoneal injection of CCl4 in the other groups of rats. Starting from the 6th week of modeling administration, they were given normal saline or corresponding drugs intragastrically at the same time. At the end of the ninth-week experiment, liver and spleen indexes of rats were calculated; the pathological structure and fibrosis changes of liver tissue were observed by HE, Masson and Sirus Red staining. The contents of alanine transaminase (ALT), aspartate transaminase (AST), procollagen type Ⅲ (PC Ⅲ), collagen type Ⅳ (COL-Ⅳ), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α) and IL-1β in serum, and hyaluronic acid (HA) and laminin (LN) in liver tissue were all detected. RESULTS Compared with the model group, the liver injury and collagen fiber deposition of rats were improved to different extents in Sanwei ganlu groups and silibinin group; the contents of ALT, AST, PC Ⅲ, COL-Ⅳ, IL-6, TNF-α and IL-1β in serum as well as the contents of HA and LN in liver tissue significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Sanwei ganlu can alleviate the progression of hepatic fibrosis in rats, possibly by inhibiting the synthesis of collagen fiber, reducing transaminase content, down-regulating the levels of HA, LN, PC Ⅲ and COL-Ⅳ, and reducing the inflammatory response.
2.Role of Autophagy in Ulcerative Colitis and Chinese Medicine Intervention: A Review
Maoguang HUANG ; Sheng XIE ; Jinxin WANG ; Feng LUO ; Yunyan ZHANG ; Yueying CHEN ; Shengnan CAI ; Xiaoyan HUANG ; Liqun LI
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(4):281-289
Ulcerative colitis (UC) is a chronic inflammatory bowel disease with complex etiology. The pathogenesis of this disease, due to a combination of factors, is complex and has not yet been elucidated. Among them, intestinal mucosal barrier damage is the basic pathological change of UC. As a non-destructive response of cells, autophagy regulates intestinal mucosal immunity, inflammation, oxidative stress, and bacterial homeostasis through degradation and reabsorption to actively repair damaged intestinal mucosal barrier, exerting a key role in the occurrence and development of UC. The disease is mainly treated clinically with aminosalicylic acid preparations, glucocorticoids, and immunosuppressants. Western medicine treatment of the disease has a fast onset of effect, and the short-term efficacy is definite, but the long-term application is easy to be accompanied by more adverse reactions. Moreover, some drugs are expensive, bringing great physical and mental pain and economic burden to patients. Therefore, it is urgent to explore new therapies with stable efficacy and mild adverse effects. In recent years, a large number of studies have shown that Chinese medicine can regulate autophagy of the intestinal mucosa with multiple targets and effects and repair the intestinal mucosal barrier function, thereby inhibiting the development of UC. Many experiments have shown that the active ingredient or monomers and compound formulas of Chinese medicine can improve the immunity of the intestinal mucosa, inflammation, oxidative stress, and flora by regulating the level of autophagy to maintain the normal function of the intestinal mucosal barrier to effectively intervene in UC, providing a new measure for the prevention and treatment of UC. However, there is a lack of systematic review of Chinese medicine in regulating the level of autophagy in the intestinal mucosa for the prevention and treatment of UC. Therefore, based on the current research on UC, autophagy process, and Chinese medicine treatment, this article reviewed the relationship of autophagy and its key target proteins with UC to clarify the key role of autophagy in UC production and systematically summarized Chinese medicines targeting the regulation of autophagy to treat UC in recent years to provide new ideas for the treatment and drug development of UC.
3.Preparation and preliminary application of the polyclonal antibody against Toxoplasma gondii dense granule protein 24
Shengnan FU ; Yun YANG ; Cong WANG ; Qingli LUO ; Li YU
Chinese Journal of Schistosomiasis Control 2024;36(3):279-285
Objective To prepare and characterize the mouse polyclonal antibody against the dense granule protein 24 (GRA24) of Toxoplasma gondii, and explore its preliminary applications. Methods The GRA24 coding sequences of different T. gondii strains were aligned using the MEGA-X software, and the dominant peptide of the GRA24 protein was analyzed with the Protean software. The base sequence encoding this peptide was amplified using PCR assay and ligated into the pET-28a vector, and the generated GRA24 truncated protein was transformed into Escherichia coli BL21. After induction by isopropyl-beta-D-thiogalactopyranoside (IPTG), the expression and purification of the recombinant GRA24 protein was analyzed using sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE). BALB/c mice were immunized by subcutaneous injection with the purified recombinant GRA24 truncated protein to generate the polyclonal antibody, and the titer of the polyclonal antibody was measured using enzyme linked immunosorbent assay (ELISA). The specificity of the polyclonal antibody was tested using Western blotting, and the intracellular localization of the polyclonal antibody was investigated using immunofluorescence assay (IFA). Results SDS-PAGE showed successful construction of the recombinant expression plasmid, and Coomassie brilliant blue staining showed the generation of the high-purity recombinant GRA24 truncated protein. ELISA measured that the titer of the polyclonal antibody against the GRA24 truncated protein was higher than 1:208 400, and Western blotting showed that the polyclonal antibody was effective to recognize the endogenous GRA24 proteins of different T. gondii strains and specifically recognize the recombinant GRA24 truncated protein. Indirect IFA showed that the GRA24 protein secreted 16 hour following T. gondii invasion in host cells. Conclusions The polyclonal antibody against the T. gondii GRA24 protein has been successfully prepared, which has a widespread applicability, high titers and a high specificity. This polyclonal antibody is available for Western blotting and IFA, which provides the basis for investigating the function of the GRA24 protein.
4.Exploring the influence and threshold effect of low density lipoprotein cholesterol in the progression of retinal arteriosclerosis using deep learning
Lan LUO ; Yaoyao SUN ; Sijin ZHOU ; Yuou YAO ; Shengnan ZHANG ; Tong MA ; Lie JU ; Xiangang CHANG ; Mingwei ZHAO
Chinese Journal of Experimental Ophthalmology 2024;42(12):1127-1133
Objective:To investigate the effect of low density lipoprotein cholesterol (LDL-C) on the progression of retinal arteriosclerosis by using a deep learning model.Methods:A cohort study was performed.Data of 1 928 individuals who underwent the medical examination at Beijing Yijiandian Clinic between January 2016 and August 2023 were reviewed, including baseline demographics, physical examination, serological test and fundus photography.Retinal arteriosclerosis was identified using a deep learning model.Five groups were divided according to LDL-C levels, including 389 subjects in group 1 (0.64-1.90 mmol/L), 387 subjects in group 2 (1.91-2.26 mmol/L), 384 subjects in group 3 (2.27-2.57 mmol/L), 385 subjects in group 4 (2.58-2.95 mmol/L), and 383 subjects in group 5 (2.96-6.06 mmol/L).The association between LDL-C levels and progression of retinal arteriosclerosis and the dose-response relationship were analyzed by logistic regression analysis and restricted cubic spline (RCS) regression model.This study adhered to the Declaration of Helsinki.The study protocol was approved by the Ethics Committee of Peking University People's Hospital (No.2021PHB058-001).Written informed consent was obtained from each subject.Results:The incidence of retinal arteriosclerosis progression was 22.10% (426/1 928) during the mean follow-up (66.84±6.58) months.The proportions of fundus progression in groups 1, 2, 3, 4, and 5 were 15.68%(61/389), 21.71%(84/387), 21.35%(82/384), 25.71%(99/385), and 26.11%(100/383), respectively, with statistical significant differences among them ( χ2=15.97, P=0.003).Using group 1 as a reference, LDL-C 2.58-2.95 mmol/L was an independent risk factor for progression of retinal arteriosclerosis ( OR=1.52, 95% CI: 1.04-2.22), and RCS analysis showed an " L" shaped association.The effect of LDL-C on retinal arteriosclerosis showed a threshold effect, with the risk of retinal arteriosclerosis progression increasing with increasing LDL-C when LDL-C was <2.34 mmol/L ( OR=1.97, 95% CI: 1.10-3.62), and stabilizing when LDL-C was ≥2.34 mmol/L. Conclusions:LDL-C has a threshold effect on the impact of retinal arteriosclerosis progression, and the threshold is 2.34 mmol/L.
5.Application of PET-based neuroimaging ATN framework in the diagnosis of Alzheimer′s disease
Min XIONG ; Hongji YOU ; Xiaoming LUO ; Yipei LIU ; Shengnan JIANG
Chinese Journal of Nuclear Medicine and Molecular Imaging 2024;44(12):705-711
Objective:To explore the value of the amyloid-tau-neurodegeneration (ATN) framework in neuroimaging based on PET for diagnosing mild cognitive impairment (MCI) and Alzheimer′s disease (AD), and analyze its relationship with clinical cognition.Methods:From May 2022 to March 2024, a total of 98 cases (23 males and 75 females, age (67.8±8.6) years) with a diagnosis of AD, MCI, or non-AD (control patients, CP) who underwent 18F-FDG, 18F-AV45, and 18F-AV1451 PET/CT imaging in the Second Affiliated Hospital of Guangzhou Medical University were included retrospectively. The clinical data, Mini-Mental State Examination (MMSE), and Montreal Cognitive Assessment (MoCA) scores were recorded. Cases were divided into MCI group, mild AD group, moderate AD group, moderate-severe AD group, and CP group. PET images were visually and semi-quantitatively evaluated. SUV mean and SUV ratio (SUVR) were obtained from independent brain regions of 18F-FDG ( n=8), 18F-AV45 ( n=14) and 18F-AV1451 ( n=14). ROC curve analysis was performed with clinical diagnosis as a criterion. The consistency between visual assessment and the clinical diagnosis was analyzed by Cohen′s Kappa coefficient. Semi-quantitative comparisons between groups were performed using the independent-sample t test, one-way analysis of variance, Mann-Whitney U test, or Kruskal-Wallis rank sum test. Age was used as a covariate to calculate the partial correlation coefficient between SUVR and cognitive scores. Results:The sensitivity and specificity of comprehensive visual assessment in diagnosing AD+ MCI were 87.65%(71/81) and 14/17 respectively, showing a moderate consistency with clinical diagnosis ( Kappa=0.60, P<0.001). Semi-quantitative analysis showed that 18F-FDG uptakes in all independent brain regions of MCI patients were higher than those of AD patients, whereas the uptakes of 18F-AV45 and 18F-AV1451 were lower ( t values: 2.66-3.95, z values: 4.98-15.04, all P<0.05). The difference in 18F-AV45 uptake among the three subgroups of AD was relatively small ( H values: 0.46-4.06, F values: 0.03-0.08, all P>0.05). Except for the medial temporal and occipital lobes, the 18F-AV1451 uptake in the moderate-severe AD group tended to be higher than that in the moderate and mild AD groups, though not statistically significant ( H values: 0.20-5.17, all P>0.05). 18F-FDG PET semi-quantitatively distinguished MCI from CP with a high sensitivity (13/14), 18F-AV45 demonstrated a high sensitivity for diagnosing AD+ MCI (92.59%, 75/81), and 18F-AV1451 had a high specificity for distinguishing AD from MCI (14/14) (AUCs: 0.87, 0.90 and 0.92). The uptakes of 18F-FDG in gray matter of AD and MCI patients were positively correlated with MMSE and MoCA scores ( r values: 0.30-0.43, 0.29-0.45, all P<0.05), while the uptakes of 18F-AV45 and 18F-AV1451 were negatively correlated with MMSE and MoCA scores ( 18F-AV45, r values: from -0.39 to -0.30, from -0.38 to -0.30, all P<0.05; 18F-AV1451, r values: from -0.50 to -0.28, from -0.53 to -0.28, except for medial temporal lobe P>0.05, all others P<0.05). Conclusion:The PET-based neuroimaging ATN framework is helpful for early diagnosis of MCI and AD, as well as for AD staging, and may reflect the disease progression and clinical cognitive status of AD to a certain extent.
6.Chinese Medicine Polysaccharides Induce Apoptosis of Gastric Cancer Cells: A Review
Jinxin WANG ; Liqun LI ; Maoguang HUANG ; Feng LUO ; Yueying CHEN ; Junling ZHANG ; Yiyi HE ; Shengnan CAI ; Sheng XIE
Chinese Journal of Experimental Traditional Medical Formulae 2023;29(24):202-209
Gastric cancer (GC) is a digestive tract tumor that occurs in the epithelial tissues of the gastric mucosa, seriously affecting the life and health of patients, and its mortality rate ranks the third among malignancies. Although medical technology has made great progress in recent years, the progression of GC still cannot be effectively controlled by surgery, chemotherapy, and targeted therapy. The pathogenesis of GC is extremely complex and is closely related to the tumor microenvironment, chronic inflammation, and immune escape, among which the reduction of tumor cell apoptosis is one of the important mechanisms for the occurrence and development of GC. Apoptosis refers to the process of spontaneous termination of cell life caused by genes under specific physiological or pathological conditions, which is of great significance for maintaining the stability of the internal environment. Researchers have found that in the GC state, mitochondrial endogenous apoptosis, endoplasmic reticulum stress, external death receptors, and other apoptosis pathways are regulated by multiple signaling pathways and genes, which together lead to the decline of GC cell apoptosis rate and thus promote the progression of GC. Chinese medicine is advantageous and characterized by multiple components, multiple targets, synergistic effect, and few adverse reactions. A large number of studies have shown that polysaccharide components, as effective components of Chinese medicine, have biological activities such as cancer inhibition, blood sugar control, anti-inflammation, antioxidant damage, and anti-virus, and can effectively inhibit the deterioration of GC by inducing cell apoptosis, gradually becoming a hot spot in GC drug research and development. However, systematic reviews on the apoptosis of GC induced by Chinese medicine polysaccharides are rarely reported. Therefore, this paper analyzed and summarized the studies of Chinese medicine polysaccharides in promoting apoptosis and interfering with GC, in order to provide a theoretical basis for the basic research, new drug development, and clinical application of Chinese medicine polysaccharides in the intervention of GC.
7.Efficacy of vitamin D adjuvant therapy for prevention of spontaneous bacterial peritonitis in patients with decompensated cirrhosis of hepatitis B
Yang ZHANG ; Haijun CHEN ; Yejin XU ; Dehe ZHANG ; Jing ZHOU ; Shengnan LUO
Chinese Journal of Clinical Infectious Diseases 2023;16(3):215-219
Objective:To evaluate the efficacy of vitamin D supplementation for prevention of spontaneous bacterial peritonitis (SBP) in patients with decompensated liver cirrhosis of hepatitis B.Methods:A total of 172 patients with decompensated cirrhosis of hepatitis B admitted in Jinhua Hospital affiliated to Zhejiang University School of Medicine from January to December 2021 were randomly divided into two groups with 86 cases in each group. Patients in both groups received conventional antiviral and symptomatic treatment; while patients in the intervention group received additinal oral vitamin D drops (800 IU/d) for 6 months. After 6 months of treatment, the incidence of SBP and the serum biochemical indexes were compared between two groups. SPSS 21.0 statistical software was used for data analysis.Results:After 6 months of treatment, the incidence of SBP in the intervention group(5.81%, 5/86) was significantly lower than that in control group(30.23%, 26/86)( χ2=19.210, P<0.01). The serum 25-(OH)D level in intervention group was significantly higher than that in the control group ( t=13.425, P=0.018), while the levels of CRP, PCT and IL-6 in intervention group were significantly lower than those in control group ( t=17.312, 10.353 and 12.218, P<0.01 or <0.05). Conclusion:Vitamin D adjuvant therapy can increase serum 25-(OH)D level, decrease serum CRP, PCT and IL-6 levels, and effectively reduce the incidence of SBP in patients with decompensated cirrhosis of hepatitis B.
8.Study on the application of sound thinking combined with Sandwich teaching method in oncology nursing teaching
Juanhua SUN ; Jingjing WANG ; Xiaomin LI ; Shengnan KONG ; Jianing LUO ; Xianna WU ; Wenhui WANG ; Mengxue WANG ; Hongmei ZHANG
Chinese Journal of Medical Education Research 2023;22(4):632-635
Objective:To explore the application of sound thinking combined with Sandwich teaching in oncology nursing practice teaching.Methods:A total of 68 nursing students who were interns in the Department of Oncology, The First Affiliated Hospital of Air Force Medical University from 2020 to 2021 were included in the study, and they were divided into a control group ( n=34) and an observation group ( n=34). The control group took routine teaching for interns, while the observation group took sound thinking combined with Sandwich teaching. The examination results, critical thinking abilities, and the evaluation of nursing teaching effectiveness of the two groups of nursing interns were evaluated. SPSS 22.0 was used for Chi-square test and t-test. Results:The examination scores of nursing students in the observation group were higher than those in the control group ( t=3.44, 2.87, 3.45, P<0.05). Compared with those before training, the scores of critical thinking ability of nursing interns in both groups increased after the training, and the observation group was better than the control group ( t=0.180, 3.64, 0.61, 2.92, 0.31, 2.74, 0.45, 2.65, 0.25, 3.58, 1.16, 2.85, 0.36, 3.20, 0.33, 2.38, P<0.05). The scores of autonomous learning ability, communication and collaboration ability, independent thinking ability, clinical reasoning ability, and problem-analyzing and -solving ability in the observation group were higher than those in the control group ( t=2.82, 3.46, 2.68, 3.29, 2.44, P<0.05). Conclusion:Combining sound thinking with Sandwich teaching in nursing clinical practice teaching in department of oncology can improve the examination scores of nursing students, improve their critical thinking abilities, and enable them to give a high evaluation of nursing teaching effectiveness.
9.Recommendations for prescription review of commonly used anti-seizure medications in treatment of children with epilepsy
Qianqian QIN ; Qian DING ; Xiaoling LIU ; Heping CAI ; Zebin CHEN ; Lina HAO ; Liang HUANG ; Yuntao JIA ; Lingyan JIAN ; Zhong LI ; Hua LIANG ; Maochang LIU ; Qinghong LU ; Xiaolan MO ; Jing MIAO ; Yanli REN ; Huajun SUN ; Yanyan SUN ; Jing XU ; Meixing YAN ; Li YANG ; Shengnan ZHANG ; Shunguo ZHANG ; Xin ZHAO ; Jie DENG ; Fang FANG ; Li GAO ; Hong HAN ; Shaoping HUANG ; Li JIANG ; Baomin LI ; Jianmin LIANG ; Jianxiang LIAO ; Zhisheng LIU ; Rong LUO ; Jing PENG ; Dan SUN ; Hua WANG ; Ye WU ; Jian YANG ; Yuqin ZHANG ; Jianmin ZHONG ; Shuizhen ZHOU ; Liping ZOU ; Yuwu JIANG ; Xiaoling WANG
Chinese Journal of Applied Clinical Pediatrics 2023;38(10):740-748
Anti-seizure medications (ASMs) are the main therapy for epilepsy.There are many kinds of ASMs with complex mechanism of action, so it is difficult for pharmacists to examine prescriptions.This paper put forward some suggestions on the indications, dosage forms/routes of administration, appropriateness of usage and dosage, combined medication and drug interaction, long-term prescription review, individual differences in pathophysiology of children, and drug selection when complicated with common epilepsy, for the reference of doctors and pharmacists.
10.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Result Analysis
Print
Save
E-mail