Objective To explore the pathogenic relationship between cell surface hydrophobicity (CSH) and adhesion of Cryptococcus neoformans (C.neoformans) to host cells. Method Some drugs and chemical agents were used to pre treat the yeast to observe the impact of iatrogenic factors on CSH, adhesion to host cells and capsule of the yeasts which were treated pretreated with low concentration of drugs and chemical agents for short duration in vitro. Results The results showed that both amphotericin B (AmB) and fluconazole (FCZ) decreased the adhesion of the yeasts, and caused vasiation of CSH. Ampicillin (AMP) had little influence on CSH and adhesion of the yeasts to host cells, but it caused characteristic ultrastructural changes of outer wall of yeasts and acapsulated changes which were reversible as AmB did. FCZ produced a different ultrazstructural change of the yeast′s wall and capsulated change. The chemical agents, such as PHA, ConA, fucose, mercaptoethanol and trypsin decreased CSH and adhesion level of the yeast while lectin increased adhesion level. Conclusion The above data suggest that there is no significant relationship among CSH, adhesion to host cells and the capsule of C.neoformans which are three independent biologic features of the cell wall surface of yeasts.

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Objective To evaluate the antigenic specificity of the enolase.Methods and Results The results included:(1)Western blot analysis demonstrated that enolase was a main protein in the nonglyco-proteins of C.albicans which could react with the serum of C.albicans infected rabbit.(2)The purified enolase was used to immunize rabbit for producing anti-enolase serum,and the hig hest titer of polyclonal antibody against enolase was up to 1:6400with enzyme-linked immunoadso rbent assay(ELISA).(3)Compared with three other polyclonal antibodies,anti-enola se antibody showed high specificity in detecting C.albicans antigen.Conclusion Enolase as a specific antigen,is worthy of further investigation in C.albicans cell.

Objective. Report of first case of Protothecosis zopfii in China and causes the skin infection in the world.Method. By clinical and laboratory examinations to confirm the diagnosis and the response to treatment. By the review of literatures to confirm the first case of human skin infection in the world.Result.From the literatures and the clinical pictures, it is confirmed that this is the first case report of Protothecosis zopfii of skin in the world.Conclusion.The first case of Protothecosis zopfii in human being was reported and successfully treated with local infiltration of Diflucan (fluconazole) 3ml (2mg/ml)/week×4.

Objective To investigate the effects of compound bifonazole solution for the treatment of superficial mycosis.Methods The study groups were treated with compound bifonazole solution and the control group with clotrimazole solution in a double-blind controlled clinical trial.The solutions were applied to skin lesions once a day.The course of treatment was two weeks for tinea corporis and tinea cruris and four weeks for tinea manus and tinea pedis.The patients were followed up weekly for two weeks after cessation of treatment and evaluated with regard to erythema,papule,blister,scale,keratinization and pruritus.Mycologic examinations were performed before,during and right after treatment and two weeks after treatment.Results A total of434patients participated into the study.The clinical cure rates of study group were82.25%in tinea corporis and tinea cruris,and68.75%tinea manus and tinea pedis,with a total response rates of95.85%and92.5%in tinea corporis and tinea cruris,and92.5%in tinea manus and tinea pedis,respectively.The clinical cure rates of control group were58.6%in tinea corporis and tinea cruris,and44.7%in tinea manus and tinea pedis,with a total response rates of83.0%and87.2%in tinea corporis and tinea cruris,and in tinea manus and tinea pedis,respectively.The MICs to350clinical isolates of pathogenic fungi were1.6~2.5mg/L for compound bifonazole solution,and3.125~25mg/L for clotrimazole solution.Conclusions Compound bifonazole solution is a high-effective,broad-spectrum anti-fungal agent.It is keratolytic,well permeable and safe for relatively long term application.

The adhesion properties of tumor cells with extracellular matrix(ECM) are closely associated with their invasion and metastasis.Our work reported here was intended reveal the relevant biomechanical and biorheological manifestations of human lung cancer. Using micropipette aspiration technique, we investigated quantitatively the adhesive mechanics properties of high metastatic human giant cell carcinoma(PG) cells as well as low metastatic adenocarcinoma(PAa) cells of lung based on cell culture in vitro. The results showed that the adhesion forces of PAa and PG cells to collagen Ⅳ were significantly higher than those to glass surfaces, but at the lower concentrations(1.00μg/ml and 2.00μg/ml) of collagen Ⅳ, the amplitude for the increase of adhesion forces of PG cells were less than the amplitude for that of PAa cells, and most of the adhesion force values of PAa cells to the coated surfaces of incorporation of laminin along with 2 μg/ml collagen Ⅳ were significantly greater than those of PG cells. At the lower concentrations(0.625μg/ml for PAa cells,and 0.625 μg/ml, 1. 25 μg/ml for PG cells) of laminin tested,the adhesion force values of PAa and PG cells all decreased, but the amplitude and level for the decreased values of adhesion forces of PG cells were greater than those for the PAa cells. In conclusion, the adhesive and proteolytic behaviour of cancer cells to extracellular matrix might be mediated mainly by tumor cell membrane receptors such as integrin receptors and laminin receptors, it might affect the biological characteristics and the metastasis of the tumor cells. The results may benefit to explain some questions in biomechanical views about how the highly metastatic PG cells are prone to migration and invasion.

Objective To investigate the value of baseline levels of aldosterone(ALD)in predicting the cardiovascular events and in-stent restenosis12 months after coronary stent implantation. Methods 268 patients with coronary heart disease admitted to the department of cardiology from January 2014 to July 2016 were selected (96 cases of stable angina pectoris and 172 cases of acute coronary syndrome).The ALD level in the preprocedural serum was detected before coronary stent implantation. According to the level of ALD,the patients were divided into two groups:ALD<130 pg/mL(n=127)and ALD≥130 pg/mL(n=141).The cardiovascular events(angina pectoris,myocardial infarction,death)and in-stent restenosis were observed and recorded 12 months after the procedures. Logistic regression analysis was done to analyze the independent risk factors of ISR. Results The baseline levels of ALD in the patients with acute coronary syndrome were significantly higher than those with stable angina pectoris[(160 ± 58)pg/mL vs.(118 ± 46)pg/mL,P < 0.05]. The cardiovascular events and those in in-stent restenosis in the patients with high baseline levels of ALD were significantly higher than those with normal baseline levels of ALD 12 months too(24.1% vs 3.1%;P<0.05;16% vs 7.4%;P<0.05).Logistic regression analysis showed that serum ALD levels were the strongest predictors of ISR,with the odds ratio of 2.56 per 10 pg/mL. Conclusions Preprocedural ALD level is a predictor for 12 months outcome of in-stent restenosis for the patents undergoing coronary stent implantation. It indicates that the complications and clinical restenosis in 12 months are markedly influenced by the activation of the rennin angiotensin aldostenone system.

In this study we examined the in vitro characteristics of tenocyte adhesion to biologically-modified surface of polymer. Polylactic-co-glycolic acid (PLGA) 85/15 films were prepared by a solvent-casting technique. Each film was adhered onto the bottom of a chamber. The film was precoated with poly-D-lysine (PDL), and then coated with serum-free F12 medium containing various concentrations of fibronectin (FN), type I collagen (CN I), and insulin-like growth factor1 (IGF-1). The monoclonal antibodies (to FN and to CN I) with various dilutions were used to inhibit attachment of tenocytes to surface precoated with FN or CN I. Human embryonic tendon cells (HETCs) and transformed human embryonic tendon cells (THETCs) were used as the seeding cells. The system used for the measurement of adhesion force was the micropipette aspiration experiment system. The micropipette was manipulated to aspirate a small portion of the tenocyte body by using a small aspiration pressure. Then the pipette was pulled away from the adhesion area by micromanipulation. The minimum force required to detach the tenocyte from the substrate was defined as the adhesion force. The results showed that modification of FN or CN I by precoating significantly enhanced attachment of tenocytes to surface of polymer (P < 0.05). As antibodies to FN or CN I were added to a polymer film precoated with FN or CN I, the adhesion force decreased significantly (P < 0.05). We concluded that the specific adhesion forces of tenocytes to extracellular matrix adhesion proteins (FN and CN I) had coordinated action and showed good dependence on their precoating concentrations, and were inhibited by the antibodies to these adhesion proteins. Films precoated with IGF-1 strongly accelerated the adhesion of tenocytes to polymer. These results indicate that the specific adhesion of tenocytes to polymer can be promoted by coating extracellular matrix adhesive proteins and insulin-like growth factor1. It is of great importance to construct tissue-engineered tendon.
Biocompatible Materials ; chemistry ; Cell Adhesion ; drug effects ; physiology ; Cells, Cultured ; Extracellular Matrix Proteins ; pharmacology ; Growth Substances ; pharmacology ; Humans ; Lactic Acid ; chemistry ; Polyglycolic Acid ; chemistry ; Polylysine ; pharmacology ; Polymers ; chemistry ; Tendons ; cytology ; embryology ; physiology ; Tissue Engineering

The Modified silk fibroin membranes were prepared by mixing the aqueous solutions of both silk fibroin and chitosan with the use of oxidized glucose aldehyde as a crosslinking agent. It was characterized by FTIR, DSC, measurements of membrane-potential and mechanical properties, the water swelling ratios and permeability coefficient for model drug 5-Fu in the different pH buffer solutions. It was shown that there were some strong hydrogen bond interaction and good compatibility between silk fibroin and chitosan molecules in the modified silk fibroin films. The isoelectric point of modified fibroin film was about pH 5.35, but that of natural fibroin film was around pH 4.5. It was also found that the mechanical properties of modified fibroin films were much better than those of fibroin itself. Its tensile strength and breaking elongation were greatly enhanced with the increase of chitosan content and their maximum values were as high as 71.4-72.7 MPa and 2.96%-3.82% respectively, at the composition of 40 wt%-60 wt% chitosan. Its coefficient of permeability decreased firstly and then increased slowly with the change of the pH value of solutions from pH 5 to pH 9, and the minimum coefficient of permeability was observed when pH=7.
Biocompatible Materials ; chemistry ; Chitosan ; chemistry ; Cross-Linking Reagents ; Delayed-Action Preparations ; Drug Carriers ; chemical synthesis ; Fibrin Fibrinogen Degradation Products ; Fibroins ; chemistry ; Hydrogen-Ion Concentration ; Membranes ; Silk ; chemistry