Objective To summarize the clinical characteristics and laboratory test results of children with Henoch - Schonlein purpura(HSP),and further to analyze the risk factors for HSP combined with cardiac damage. Methods The clinical and laboratory tests findings from 707 children diagnosed as HSP at Nanjing Children's Hospi-tal were retrospectively analyzed,who were recruited from November 2011 to December 2012. The possible risk factors for HSP with cardiac damage in children were recorded,including gender,age,predisposing causes,gastrointestinal symptoms,joint pain,kidney disorders,serum electrolytes,anti - streptolysin 〝O〝 test,erythrocyte sedimentation rate, and complement level were summarized. Chi - square test and Logistic regression were performed to analyze the risk fac-tors of cardiac damage in children with HSP. Results Among 707 cases,192(27. 2% )patients were combined with car-diac damage,115 male and 77 female,and the proportion of men to women was 1. 00: 0. 67;age ranged from 11 months to 15 years and 4 months(6 years and 5 months for median age),6 patients ﹤ 3 years old occupying 3. 1% ,103 patients≥3 - 7 years old occupying 53. 7% ,82 patients≥7 - 14 years old occupying 42. 7% ,1 patient≥14 years old occupying 0. 5% ,and the age of onset in preschool and school age. Electrocardiogram(ECG)abnormalities were found in 190 patients,the main manifestations including long Q - T interval,ST - T segment falling down and sinus bradycar-dia,and one or more items of abnormal myocardial enzymes existed in 24 cases;echocardiography was performed in 35 cases of children,but no abnormality was detected,no obvious symptoms such as flustered or chest tightness or precor-dial distress. Statistical analysis showed that gender,predisposing causes,mixed HSP,complement level were related to the incidence of cardiac damage in children with HSP(P ﹤ 0. 05). Furthermore binary Logistic regression identified that in male patients,the ratio of X1 vs OR ratio was 0. 654(95% CI 0. 462 - 0. 926,P ﹤ 0. 05),for predisposing causes,the ratio of X2 vs OR ratio was 2. 63(95% CI 1. 838 - 3. 765,P ﹤ 0. 001),for mixed HSP,the ratio of X3 vs OR ratio was 2. 452(95% CI 1. 301 - 4. 621,P ﹤ 0. 01),which were independent factors for cardiac damage in chil-dren with HSP. Conclusions ECG and/ or myocardial enzyme spectrum abnormalities are the main clinical ma-nifestations of cardiac damage in children with HSP. Male patients,predisposing causes of the respiratory tract infec-tion,mixed HSP and hypocomplementemia were high risk factors in the development of cardiac damage,which require special consideration clinically,and earlier ECG and myocardial enzymes examination,early diagnosis and treatment are necessary to avoid the occurrence of severe cases.

Objective To investigate the clinicopathological characteristics and prognosis of Henoch-Schonlein purpura nephritis with diffused endothelial cell proliferation (DEP-HSPN) in children. Methods Data of 8 DEP-HSPN cases in Nanjing Children's Hospital within recent ten years were retrospectively reviewed. The clinicopathological features, efficacy and prognosis were compared between DEP-HSPN cases and 48 cases of non-DEP-HSPN. Non-DEP-HSPN cases were divided into two groups according to the clinical classification or the pathological classification.Results (1) In DEP-HSPN, HSP developed nephritis within 4 to 15 days after the initial onset of purpuric rashes. Hematuria was present in all the 8 patients. The main clinical manifestation of DEP-HSPN was nephritic-nephrotic syndrome (4 cases), nephrotic level proteinuria (3 cases) and acute nephritic syndrome (1 case). Four cases had macrohematuria. Six cases had abdominal symptoms and two cases had arthritis. Pathology of all the cases showed grade Ⅲ-b lesion with diffused endocapillary proliferation and segmental necrotizing lesion of the capillary wall, always accompanied with intraglomerular inflammatory cell infiltration. Crescent was found in 4 cases. (2)Compared to non-DEP-HSPN grades Ⅲ, DEP-HSPN showed a shorter course of disease.Macrohematuria, heavy proteinuria, nephritic-nephrotic syndrome, and segmental necrotizing lesion of capillary wall were more common in DEP-HSPN. Compared to non-DEP-HSPN with nephrotic level proteinuria, DEP-HSPN had a lower rate of crescent. (3) Methylprednisolone pulse therapy in early stage, then prednisone combined with cyclophosphamide were used in the treatment of DEP-HSPN.After an average follow-up period of seven months, one patient showed complete remission, five showed persistent microhematuria, and two showed persistent microhematuria accompanied with minor proteinuria. No significant difference of prognosis was found between DEP-HSPN and nonDEP-HSPN. Conclusions DEP-HSPN has an acute onset. The main clinical manifestation of DEP-HSPN is nephritic-nephrotic syndrome and nephrotic level proteinuria, always accompanied with macrohematuria. Immunosuppressant treatment in the early stage of disease is effective for a short-term outcome.

Objective To investigate the clinicopathological characteristics and treatment of C1q nephropathy in children.Methods Data of 23 C1q nephropathy cases in Nanjing Children's Hospital during recent eight years were retrospectively reviewed. Results The incidence of C1q nephropathy was 4.78％ in primary glomerulonephritis proven by biopsy.Among 23 patients,15 were boys and 8 were girls.The mean age at onset was (5.0±3.4) years old with a range of 0.9-12.4 years.The clinical manifestations included nephrotic syndrome(NS) in 18 cases (78.3％),nephrotic-range proteinuria in 4 cases(17.4％) and microhematuria in 1 case.Two patients with NS and one patient with nephrotic-range proteinuria also presented microhematuria.One patient with NS who received oral herbal medicine for two weeks developed acute renal insufficiency at the same time of diagnosis.Three cases had a family history of kidney disease,among them two patients(presented nephrotic range proteinuria) were siblings,their father had proteinuria as well,and routine genetic examination confirmed familial Denys-Drash syndrome in association with C1q nephropathy.One NS patient's sister had nephrotic-range proteinuria too,but renal biopsy was not performed.No patient had hypertension.None of the patients had low C3 or C4 levels,and serological markers of systemic lupus erythematosus were absent.Light microscopy showedminimalchangedisease (MCD)in13cases (56.5％), mesangialproliferative glomerulonephritis(MsPGN) in 6(26.1％) and focal segmental glomerulosclerosis(FSGS) in 4(17.4％).Immunofluorescence displayed C1q co-deposits of IgG(78.3％),IgM(78.3％),IgA (34.8％) and C3 (47.8％),and a full-house pattern was found in 6 patients (26.1％).Electron microscopy revealed 4 out of 19 had mesangial deposits,except for 4 patients whose glomerulus could not be found.Children with either NS(18 cases) or nephrotic-range proteinuria(2 cases)received prednisone,among them,15 were steroid-resistant,4 were steroid-dependent,only 1 was steroid-sensitive.Those with steroid-resistant(15 cases) or steroid-dependent(3 cases) received further immunosuppression with cyclophosphamide(CTX) or cyclosporine A (CsA).One NS case of steroid-dependent received prednisone re-induction therapy.The siblings associated with DenysDrash syndrome and one case presented microhematuria were commenced on angiotensin-converting enzyme inhibitor(ACEI).Of the 19 patients with sufficient follow-up date,15 cases (78.9％)achieved complete remission,2 cases(10.5％) achieved partial remission,and 2 cases (10.5％) were ineffective.Median follow-up was 15 months.Remission of the NS occurred in 94.4％ (17/18)while nephrotic-range proteinuria was 50.0％(2/4).Remission of MCD was 100.0％,MsPGN was 83.4％(5/6),but FSGS was only 50.0％(2/4).Conclusions C1q nephropathy is rare,and often manifests as steroid-resistant or steroid-dependent NS and nephrotic-range proteinuria.The most common histological feature is MCD,and some as MsPGN or FSGS.A combination of prednisone and immunosuppressive agent is always effective for MCD and MsPGN,but FSGS always has a poor response.

Objective To analyze the clinicopathological features and prognosis of minimal change nephropa-thy with IgA deposition(MCD-IgA)in children.Methods The clinical and pathological data of 10 cases in Chil-dren's Hospital of Nanjing Medical University from January 2010 to December 2015 with MCD-IgA were retrospective-ly analyzed,and 24 cases of minimal change nephrotic syndrome(MCD-NS)and 21 cases of IgA nephropathy clini-cally manifested with nephrotic syndrome(NS-IgAN)were selected as controls.Results (1)Clinical manifesta-tions:there were no significant differences in age,gender,incidence of hematuria,level of 24 hours urine protein,serum albumin and cholesterol levels and elevated serum IgA ratio in MCD-IgA compared with MCD-NS group.Compared with MCD-IgA and MCD-NS,NS -IgAN group showed older age of onset[(8.6 ± 2.1)years vs.(4.8 ± 2.4) years,(4.0 ± 1.6)years],higher level of serum albumin[(22.8 ± 4.3)g/L vs.(19.0 ± 1.9)g/L,(16.8 ± 3.0) g/L],and lower level of serum total cholesterol[(7.9 ± 1.9)mmol/L vs.(9.9 ± 2.7)mmol/L,(9.8 ± 2.1)mmol/L], and all the differences were significant(all P<0.05).NS-IgAN group was all associated with gross hematuria.(2) Pathology:the light microscope lesions in MCD-IgA and MCD-NS group were mild,but it was usually associated with severe histologic lesions in NS-IgAN,such as endocapillary proliferation,segmental sclerosis,crescent formation,tuft necrosis and chronic tubulointerstitial lesions;in MCD -NS group,immunofluorescence was negative. In MCD -IgA group,IgA deposition intensity was weak(less than + +),and 3 cases(30.0%)were accompanied with C3deposi-tion.In NS-IgAN group,IgA deposition intensity was stronger(more than + + +),and most of the cases were accom-panied with C3and other immunoglobulins deposition.Under electron microscope,both MCD-IgA and MCD-NS showed wide foot process effacement,and a small amount of mesangial electron dense deposit was detected in 9 cases of MCD-IgA.In NS-IgAN group,large amount of electron dense deposit was found in the mesangial region,and only 8 cases (38.0%)showed more than 50% of foot process effacement.(3)Prognosis:in MCD-IgA group,9 patients were ster-oid-dependent or frequently relapsed,1 case showed steroid-resistance,6 patients required additional agents.Except 1 case lost,with an average of(61.5 ± 28.8)months were followed up,8 patients achieved complete remission;In MCD-NS group,20 cases were steroid-dependent or frequently relapsed,4 cases were steroid-resistant,23 cases re-quired additional immunosuppressive agents.Followed up for an average of(36.4 ± 12.5)months,22 cases(91.7%) achieved complete remission;In NS-IgAN group,all cases were steroid-resistant and combined with cyclophospha-mide treatment;followed up for an average of(38.6 ± 15.2)months,19 cases(90.5%)achieved complete remission. Conclusions The clinical manifestations and prognosis of MCD-IgA were similar to MCD-NS,but the clinical and pathological findings of MCD-IgA were different from those of NS-IgAN.It is deduced that the nature of MCD-IgA is still a MCD,and that the IgA deposition may be nonspecific.

Objective: To summarize the clinical features and genetic analysis results of 10 children with Dent disease. Methods: The clinical data and gene test results of 10 boys aged from 8 months to 12 years with Dent disease diagnosed in Children's Hospital of Nanjing Medical University from January 2014 to July 2017 were analyzed retrospectively. Results: All patients had insidious onset, 5 cases were found to have proteinuria on routine urine examination after hospitalization duo to other diseases, 4 cases were admitted to hospital because increased foams in the urine, and 1 case was found to have proteinuria on health checkup. All cases presented with low molecular weight proteinuria, urine protein electrophoresis showed that the proportion of low molecular weight protein was greater than 50%, 7 cases had nephrotic-range proteinuria, but none had hypoproteinemia. Six cases had hypercalciuria, 3 cases had nephrocalcinosis, 1 case had nephrolithiasis, 2 cases had glomerular microscopic hematuria, in 1 case urine glucose wa weakly positive but blood glucose was normal. All patients had normal renal function, normal serum calcium, no hypophosphoremia and none had rickets. Genetic analysis results showed that 7 patients with variants in the CLCN5 gene, including 2 nonsense variants (p.R637X, p.Y143X), 3 missense variants (p.A540D, p.G135E, p.G703V), 1 deletion variant (exons 9, 10, 11, 12, 13, 1 missing), and 1 frameshift variant (p.T260Tfs*10). Three cases had missense variants of OCRL gene (p.I274T, p.I371T, p.F399S). Except for p.R637X and p.I274T, the other 8 cases had newly discovered variants. Five patients underwent a renal biopsy, the biopsy revealed focal global glomerulosclerosis in 3 patients, mild mesangial proliferative glomerulonephritis in 1 patient and renal minimal change in 1 patient. Mild focal tubular atrophy and interstitial fibrosis were noted in three cases. Mild segmental foot process effacement was noted under electron microscope in all five cases. Conclusions All the children with Dent disease had insidious onset, low molecular weight proteinuria is the main clinical manifestation, most cases presented with nephrotic-range proteinuria, but there was no hypoalbuminemia, some cases were not associated with hypercalciuria. The pathogenic genes in most cases were CLCN5 and a few were OCRL. The types of genetic variation include missense variant, nonsense variant, deletion variant and frameshift variant. Although Dent disease is a renal tubular disease, renal biopsy suggests that most cases are associated with glomerular lesions.

Objective To summarize the cLinicaL data and moLecuLar characteristics of two sibLings with Fechtner syndrome. Methods A retrospective anaLysis was made on the cLinicaL data, Laboratory tests and genetic test resuLts of two sibLings with Fechtner syndrome in a famiLy who were foLLowed up in the Department of NephroLogy, ChiLdren′s HospitaL AffiLiated to Nanjing MedicaL University from ApriL 2018 to August 2018. ResuLts Both sibLings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant pLateLets and Leucocyte incLusions were easiLy seen in peripheraL bLood smears and bone marrow ceLLs, but the resuLts of renaL function, hearing and ophthaLmoLogic examinations were normaL. The father of the sibLings presented with proteinuria, thrombocytopenia, and hearing Loss. At the age of 26 years, he deveLoped uremia and now requires hemodiaLysis. The renaL biopsy of the eLder sister suggested focaL segmentaL gLomeruLoscLerosis. Gene anaLysis showed that the sibLings and their father MYH9 gene 25 exon c. 3195_c. 3215 deLCGAGCTCCAGCCCAGATCGC (p. A1065_A1072 deL) deLetion mutation. The eLder sister was treated with benazepriL hydrochLoride for 4 months and the proteinuria was improved. Her younger brother was given tacroLimus for 3 months, but the proteinuria did not improve significantLy, then benazepriL hydrochLoride was given for 1 month and proteinuria improved. ConcLusions Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant pLateLets and Leucocyte incLusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deLetion mutation of p.A1065_A1072deL is the second internationaL report. Angiotensin?converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.

Objective:To investigate the clinical manifestations, pathological characteristics, treatment and prognosis of anti-neutrophil cytoplasmic antibody-associated vasculitis (AAV) in 13 children.Methods:The clinical and pathological data of 13 cases of AAV in children′s Hospital of Nanjing Medical University from June 2000 to December 2021 were retrospectively analyzed.Results:Among the 13 cases, 12 cases were diagnosed with microscopic polyangiitis (MPA) and 1 case was granulomatosis with polyangiitis (GPA), including 10 females and 3 males. The onset age ranged from 3 years and 11 months to 13 years and 10 months. The most frequently involved organ was the kidney (12 cases, 92.3%), followed by respiratory system (7 cases, 53.8%), skin (5 cases, 38.5%), digestive system (4 cases, 30.8%), nervous system (4 cases, 30.8%) and cardiovascular system (3 cases, 23.1%). There were 10 cases with orthotic anemia, 7 cases with positive antinuclear antibody, and 3 cases with mildly decreased complement C3. Among the 12 children with renal impairment, 9 cases were accompanied by abnormal renal function at the beginning of the disease. Renal biopsy was classified according to the Berden as follows: sclerotic in 5 cases, crescentic 3 cases, focal in 2 cases and mixed in 2 cases. All children were treated with glucocorticoid combined with immunosuppressant. During the follow-up time from 8 months to 128 months, 4 cases acquired complete remission, 8 cases achieved partial remission and 1 case recurred after complete remission, and 7 cases progressed to chronic kidney disease stage 5. Three children with complete remission underwent repeated renal biopsy, including 2 cases of mixed type and 1 case of crescent type initially, and all changed to focal type.Conclusions:AAV in children occurs mainly in school-age female, and most of AAV in children is MPA. The clinical manifestations are various. Most of them have renal damage and anemia, and lung damage is also common. Patients with skin purpura onset may be misdiagnosed as Henoch-Schonlein purpura, and AAV with ANA positive or complement reduction should exclude systemic lupus erythematosus. Once the renal function is abnormal in AAV, especially estimated glomerular filtration rate<60 ml·min -1·(1.73 m 2) -1 and the pathological classification is sclerotic type or crescent type, it is difficult to reverse even after active treatment. Early diagnosis and treatment are very important for AAV.

Objective:To analyze the clinical and pathological features of adolescent- onset primary nephrotic syndrome (PNS) in children (10 years≤age≤18 years), so as to explore the renal biopsy indications in adolescent-onset PNS.Methods:It was a single-center retrospective observational study. The clinical and pathological data of adolescent-onset PNS (age≥10 years) who underwent renal biopsy in Children's Hospital Affiliated to Nanjing Medical University from December 2004 to June 2022 were analyzed retrospectively.Results:A total of 110 children were included in the study, including 76 males (69.1%) and 34 females (30.9%), with the onset age ranging from 10 years to 14 years and 9 months. Forty-nine cases (44.5%) were accompanied by hematuria, including 14 cases (12.7%) of gross hematuria and 35 cases (31.8%) of microscopic hematuria. Twenty-five cases (22.7%) had hypertension, 19 cases (17.3%) had renal insufficiency, and 4 cases (3.6%) had low complement C3 at the onset. Fifty-two cases (47.3%) were steroid sensitive nephrotic syndrome and 58 cases (52.7%) were steroid resistant nephrotic syndrome. Biopsy results showed that minimal change disease(MCD) was the most common histopathological subtype (47.3%, 52 case), followed by focal segmental glomerulosclerosis (FSGS) in 22 cases (20.0%), IgA nephropathy (IgAN) in 17 cases (15.5%), membranous nephropathy (MN) in 7 cases (6.4%), mesangial proliferative glomerulonephritis in 5 cases (4.5%), IgM nephropathy in 4 cases (3.6%), membranous proliferative glomerulonephritis in 2 cases (1.8%), and C1q nephropathy in 1 case (0.9%). Among 44 children with simple type nephrotic syndrome, the pathological type was mainly MCD (77.3%), and 66 children with nephritic type nephrotic syndrome were mostly non-MCD (72.7%), such as IgAN, FSGS, MN, etc. If there are two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency or low C3 levels, the proportion of non-MCD would further increase to 92.0%(23/25). The pathological type of patient with gross hematuria or low C3-emia was non-MCD. The frequency of hematuria (69.0% vs. 17.3%, χ2=29.619, P<0.001), hypertension (31.0% vs. 13.5%, χ2=4.821, P=0.028) and renal insufficiency (24.1% vs. 9.6%, χ2=4.047, P=0.044) in non-MCD group was significantly higher than those in MCD group. Conclusions:If the clinical manifestation of PNS in adolescent over 10 years old is simple type nephrotic syndrome, the histopathological lesion is mostly MCD, and most of them are steroid sensitive. It is recommended to give hormone treatment first, and then perform renal biopsy if steroid resistance occurs; If the clinical manifestation is nephritic type nephrotic syndrome, the histopathological lesion is mostly non-MCD, especially those with gross hematuria or low C3-emia, or those have two or more clinical manifestations of persistent hematuria, hypertension, renal insufficiency and hypocomplement C3-emia, a kidney biopsy should be performed at onset.

Objective:To analyze the clinical characteristics of pediatric atypical hemolytic uremic syndrome (aHUS), and provide clinical experience for the diagnosis and treatment of aHUS in China.Methods:It was a single-center retrospective study. Fifteen aHUS children treated and having complete clinical data at Children's Hospital of Nanjing Medical University between December 31, 2017 and October 15, 2023 were enrolled to analyze the clinical features covering laboratory examinations, genetic testing results, and clinical manifestations. The children were classified based on genetic testing and complement factor H (CFH) antibody detection results to analyze the corresponding clinical characteristics.Results:Among the 15 aHUS patients. There were 8 males and 7 females. The onset age was 5.1 (0.7, 10.8) years old. All patients underwent genetic testing, with 9/15 of aHUS-related gene mutation, revealing 2 de novo mutations in complement factors-related genes. Among 11 patients screened for CFH antibody, 6 tested positive. C3 was detected in 14 patients , and C3 decreased in 9 patients. In laboratory examinations, there were notable decreases in red blood cell (RBC) count in 13 patients, platelet (PLT) count in 15 patients, hemoglobin (Hb) in 15 patients and estimated glomerular filtration rate (eGFR) in 14 patients. Blood urea nitrogen (BUN) and serum creatinine (Scr) were markedly elevated in 13 patients and 9 patients, respectively. Twelve patients exhibited elevated transaminase levels, and 14 patients exhibited elevated lactate dehydrogenase (LDH) levels. Clinically, 11 patients had triggers, and 4 patients had clear family histories. Common clinical features including anemia, thrombocytopenia, proteinuria and hematuria were in 15 patients. There were statistically significant differences in RBC count ( Z=-2.84, P=0.005), PLT count ( Z=-6.65, P<0.001), Hb ( t=-3.71, P=0.002), LDH ( Z=3.76, P=0.002), BUN ( Z=2.71, P=0.017), and eGFR ( Z=-3.65, P=0.003) before and after treatment except alanine transaminase, aspartate transaminase, Scr and complement C3 (all P>0.05). There were no significant differences in onset age, RBC count, PLT count, Hb, LDH, alanine transaminase, aspartate transaminase, Scr, BUN, eGFR, and C3 between aHUS-related gene mutation and non-mutation groups, and CFH antibody-positive and negative groups (all P>0.05). Conclusions:aHUS is marked by severity, and has diverse clinical manifestations. There are no significant differences in clinical presentation at admission between hereditary and acquired aHUS, highlighting the critical importance of genetic testing and complement-related factor detection in diagnosing aHUS etiology. The family history plays a supportive role in diagnosis of aHUS.

OBJECTIVE To set up normal ranges for indexes in embryo-fetal development toxicity studies in Sprague-Dawley(SD)rats and to establish a background database to provide reference for the embryo-fetal development toxicity evaluation of drugs.METHODS The data on embryonic develop-ment and fetal growth from embryo-fetal development toxicity studies(11 items)conducted by our center between 2013 and 2022 was statistically analyzed,involving 205 pregnant rats and 3037 fetuses in total,with the mean and standard deviation,coefficient of variation and 95%confidence interval calculated.The indexes included body mass,body mass gain and food consumption during pregnancy,pregnancy outcomes(pregnancy rate,average corpora lutea,average Implant sites,average live conceptuses,live conceptuse rate,resorption rate and dead conceptuse rate),fetal growth and development(fetal mass,placental mass and sex ratio),appearance abnormality rate,visceral abnormality rate,and skeletal abnormality rate.RESULTS The mass of pregnant rats trended up during gestation,with significant increases in the late period.Food consumption increased along with gestation.Caesarean section was conducted on gestation day 20,and the pregnancy rate was 93.2%.The average corpora lutea,Implant sites and live conceptuses were 18.0±3.2,15.9±2.8 and 14.8±3.0,respectively.The live conceptuse rate was 93.4%while the total dead embryo rate was 6.6%.The average mass of fetuses and placenta were respectively 3.6±0.3 and(0.6±0.3)g,and the fetal sex ratio(male/female)was 0.94.The incidence of fetal appearance abnormalities was about 0.2%,and that of soft tissue abnormalities was approximately 0.8%.The rate of skeletal abnormalities was about 1.2%,with higher incidence of non-ossification and incomplete ossification mostly identified on sternum and hyoid bone.The numbers of ossifications of metacarpal bones,metatarsal bones and sacrococcygeal vertebrae were 7.0±0.7,8.0±0.1 and 7.4±0.5,respectively.The rate of ossification of sternumⅠtoⅣwas higher,with an average of about 98.6%-99.9%.The ossification rates of sternum Ⅴ and Ⅵ were(68.0±28.4)%and(82.8±23.9)%.CONCLUSION The background database of indexes in the embryo-fetal development toxicity study on SD rats is established for our GLP laboratory,which provides reference for reproductive toxicity studies.