AIM: To observe the effect of continuous inhaled nitric oxide (NO) on airway resistance in guinea pigs. METHODS: 36 healthy male guinea pigs were divided into control group, isoproterenol group and two inhaled NO (20?10 -6 and 60?10 -6 ) groups. Respiratory resistance (R_E) and dynamic compliance(C_ dyn )were recorded before and after evoked by histamine at different doses. RESULTS: After injections of intravenous histamine at 80,120 and 160 ?g/kg, the R_E of inhaled NO groups were apparently lower than that of control group. Compared with control group, the C_ dyn of inhaled NO groups were significantly higher after administration of histamine at 80, 120 and 160 ?g/kg. After given histamine at more than 80 ?g/kg,the R_E of inhaled NO groups were higher and the C_ dyn lower than those of isoproterenol group. CONCLUSION: Inhalation of 20?10 -6 NO and 60?10 -6 NO can inhibit the increase in airway resistance induced by higher doses (80,120 and 160 ?g/kg )of intravenous histamine, but the effect of intravenous isoproterenol seems stronger.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To summarize the clinical characteristics and laboratory test results of children with Henoch - Schonlein purpura(HSP),and further to analyze the risk factors for HSP combined with cardiac damage. Methods The clinical and laboratory tests findings from 707 children diagnosed as HSP at Nanjing Children's Hospi-tal were retrospectively analyzed,who were recruited from November 2011 to December 2012. The possible risk factors for HSP with cardiac damage in children were recorded,including gender,age,predisposing causes,gastrointestinal symptoms,joint pain,kidney disorders,serum electrolytes,anti - streptolysin 〝O〝 test,erythrocyte sedimentation rate, and complement level were summarized. Chi - square test and Logistic regression were performed to analyze the risk fac-tors of cardiac damage in children with HSP. Results Among 707 cases,192(27. 2% )patients were combined with car-diac damage,115 male and 77 female,and the proportion of men to women was 1. 00: 0. 67;age ranged from 11 months to 15 years and 4 months(6 years and 5 months for median age),6 patients ﹤ 3 years old occupying 3. 1% ,103 patients≥3 - 7 years old occupying 53. 7% ,82 patients≥7 - 14 years old occupying 42. 7% ,1 patient≥14 years old occupying 0. 5% ,and the age of onset in preschool and school age. Electrocardiogram(ECG)abnormalities were found in 190 patients,the main manifestations including long Q - T interval,ST - T segment falling down and sinus bradycar-dia,and one or more items of abnormal myocardial enzymes existed in 24 cases;echocardiography was performed in 35 cases of children,but no abnormality was detected,no obvious symptoms such as flustered or chest tightness or precor-dial distress. Statistical analysis showed that gender,predisposing causes,mixed HSP,complement level were related to the incidence of cardiac damage in children with HSP(P ﹤ 0. 05). Furthermore binary Logistic regression identified that in male patients,the ratio of X1 vs OR ratio was 0. 654(95% CI 0. 462 - 0. 926,P ﹤ 0. 05),for predisposing causes,the ratio of X2 vs OR ratio was 2. 63(95% CI 1. 838 - 3. 765,P ﹤ 0. 001),for mixed HSP,the ratio of X3 vs OR ratio was 2. 452(95% CI 1. 301 - 4. 621,P ﹤ 0. 01),which were independent factors for cardiac damage in chil-dren with HSP. Conclusions ECG and/ or myocardial enzyme spectrum abnormalities are the main clinical ma-nifestations of cardiac damage in children with HSP. Male patients,predisposing causes of the respiratory tract infec-tion,mixed HSP and hypocomplementemia were high risk factors in the development of cardiac damage,which require special consideration clinically,and earlier ECG and myocardial enzymes examination,early diagnosis and treatment are necessary to avoid the occurrence of severe cases.

OBJECTIVE To set up normal ranges for indexes in embryo-fetal development toxicity studies in Sprague-Dawley(SD)rats and to establish a background database to provide reference for the embryo-fetal development toxicity evaluation of drugs.METHODS The data on embryonic develop-ment and fetal growth from embryo-fetal development toxicity studies(11 items)conducted by our center between 2013 and 2022 was statistically analyzed,involving 205 pregnant rats and 3037 fetuses in total,with the mean and standard deviation,coefficient of variation and 95%confidence interval calculated.The indexes included body mass,body mass gain and food consumption during pregnancy,pregnancy outcomes(pregnancy rate,average corpora lutea,average Implant sites,average live conceptuses,live conceptuse rate,resorption rate and dead conceptuse rate),fetal growth and development(fetal mass,placental mass and sex ratio),appearance abnormality rate,visceral abnormality rate,and skeletal abnormality rate.RESULTS The mass of pregnant rats trended up during gestation,with significant increases in the late period.Food consumption increased along with gestation.Caesarean section was conducted on gestation day 20,and the pregnancy rate was 93.2%.The average corpora lutea,Implant sites and live conceptuses were 18.0±3.2,15.9±2.8 and 14.8±3.0,respectively.The live conceptuse rate was 93.4%while the total dead embryo rate was 6.6%.The average mass of fetuses and placenta were respectively 3.6±0.3 and(0.6±0.3)g,and the fetal sex ratio(male/female)was 0.94.The incidence of fetal appearance abnormalities was about 0.2%,and that of soft tissue abnormalities was approximately 0.8%.The rate of skeletal abnormalities was about 1.2%,with higher incidence of non-ossification and incomplete ossification mostly identified on sternum and hyoid bone.The numbers of ossifications of metacarpal bones,metatarsal bones and sacrococcygeal vertebrae were 7.0±0.7,8.0±0.1 and 7.4±0.5,respectively.The rate of ossification of sternumⅠtoⅣwas higher,with an average of about 98.6%-99.9%.The ossification rates of sternum Ⅴ and Ⅵ were(68.0±28.4)%and(82.8±23.9)%.CONCLUSION The background database of indexes in the embryo-fetal development toxicity study on SD rats is established for our GLP laboratory,which provides reference for reproductive toxicity studies.