AIM: To observe the effect of continuous inhaled nitric oxide (NO) on airway resistance in guinea pigs. METHODS: 36 healthy male guinea pigs were divided into control group, isoproterenol group and two inhaled NO (20?10 -6 and 60?10 -6 ) groups. Respiratory resistance (R_E) and dynamic compliance(C_ dyn )were recorded before and after evoked by histamine at different doses. RESULTS: After injections of intravenous histamine at 80,120 and 160 ?g/kg, the R_E of inhaled NO groups were apparently lower than that of control group. Compared with control group, the C_ dyn of inhaled NO groups were significantly higher after administration of histamine at 80, 120 and 160 ?g/kg. After given histamine at more than 80 ?g/kg,the R_E of inhaled NO groups were higher and the C_ dyn lower than those of isoproterenol group. CONCLUSION: Inhalation of 20?10 -6 NO and 60?10 -6 NO can inhibit the increase in airway resistance induced by higher doses (80,120 and 160 ?g/kg )of intravenous histamine, but the effect of intravenous isoproterenol seems stronger.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.