AIM: To observe the effect of continuous inhaled nitric oxide (NO) on airway resistance in guinea pigs. METHODS: 36 healthy male guinea pigs were divided into control group, isoproterenol group and two inhaled NO (20?10 -6 and 60?10 -6 ) groups. Respiratory resistance (R_E) and dynamic compliance(C_ dyn )were recorded before and after evoked by histamine at different doses. RESULTS: After injections of intravenous histamine at 80,120 and 160 ?g/kg, the R_E of inhaled NO groups were apparently lower than that of control group. Compared with control group, the C_ dyn of inhaled NO groups were significantly higher after administration of histamine at 80, 120 and 160 ?g/kg. After given histamine at more than 80 ?g/kg,the R_E of inhaled NO groups were higher and the C_ dyn lower than those of isoproterenol group. CONCLUSION: Inhalation of 20?10 -6 NO and 60?10 -6 NO can inhibit the increase in airway resistance induced by higher doses (80,120 and 160 ?g/kg )of intravenous histamine, but the effect of intravenous isoproterenol seems stronger.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective:To analyze the clinical characteristics of pediatric atypical hemolytic uremic syndrome (aHUS), and provide clinical experience for the diagnosis and treatment of aHUS in China.Methods:It was a single-center retrospective study. Fifteen aHUS children treated and having complete clinical data at Children's Hospital of Nanjing Medical University between December 31, 2017 and October 15, 2023 were enrolled to analyze the clinical features covering laboratory examinations, genetic testing results, and clinical manifestations. The children were classified based on genetic testing and complement factor H (CFH) antibody detection results to analyze the corresponding clinical characteristics.Results:Among the 15 aHUS patients. There were 8 males and 7 females. The onset age was 5.1 (0.7, 10.8) years old. All patients underwent genetic testing, with 9/15 of aHUS-related gene mutation, revealing 2 de novo mutations in complement factors-related genes. Among 11 patients screened for CFH antibody, 6 tested positive. C3 was detected in 14 patients , and C3 decreased in 9 patients. In laboratory examinations, there were notable decreases in red blood cell (RBC) count in 13 patients, platelet (PLT) count in 15 patients, hemoglobin (Hb) in 15 patients and estimated glomerular filtration rate (eGFR) in 14 patients. Blood urea nitrogen (BUN) and serum creatinine (Scr) were markedly elevated in 13 patients and 9 patients, respectively. Twelve patients exhibited elevated transaminase levels, and 14 patients exhibited elevated lactate dehydrogenase (LDH) levels. Clinically, 11 patients had triggers, and 4 patients had clear family histories. Common clinical features including anemia, thrombocytopenia, proteinuria and hematuria were in 15 patients. There were statistically significant differences in RBC count ( Z=-2.84, P=0.005), PLT count ( Z=-6.65, P<0.001), Hb ( t=-3.71, P=0.002), LDH ( Z=3.76, P=0.002), BUN ( Z=2.71, P=0.017), and eGFR ( Z=-3.65, P=0.003) before and after treatment except alanine transaminase, aspartate transaminase, Scr and complement C3 (all P>0.05). There were no significant differences in onset age, RBC count, PLT count, Hb, LDH, alanine transaminase, aspartate transaminase, Scr, BUN, eGFR, and C3 between aHUS-related gene mutation and non-mutation groups, and CFH antibody-positive and negative groups (all P>0.05). Conclusions:aHUS is marked by severity, and has diverse clinical manifestations. There are no significant differences in clinical presentation at admission between hereditary and acquired aHUS, highlighting the critical importance of genetic testing and complement-related factor detection in diagnosing aHUS etiology. The family history plays a supportive role in diagnosis of aHUS.

ObjectiveTo establish background data for a 90-day feeding trial of SD rats to ensure the reliability of research data. MethodsBackground data from six independent 90-day feeding trials of SD rats conducted by the National Center for Safety Evaluation of Drugs from 2020 to 2023 were summarized. These studies involved a blank control group of 120 SPF-grade 4-week-old SD rats, with an equal number of males and females, which were only given standard full-nutrient pelleted rat feed. After the quarantine period, the animals were observed for an additional 90 days, followed by intraperitoneal injection of Zoletil (50 mg/mL) for anesthesia, blood sampling, euthanasia, and necropsy. By analyzing the data from the blank control group, a relevant background database for SD rats was established. ResultsBoth male and female rats exhibited steady weight gain, with a more pronounced increase in male rats. Within 90 days, the average body weight of male and female rats increased to over 500 g and 300 g, respectively. Three weeks later, the average daily food intake of male rats stabilized at approximately 25~28 g per rat, while that of female rats remained stable at approximately 16~19 g per rat. The food utilization rate of all animals gradually decreased from the first week of the experiment. In the white blood cell (WBC) differential count results, significant differences were observed in the counts of WBCs, neutrophils (Neut), lymphocytes (Lymph), and monocytes (Mono) between males and females (P<0.001). However, there were no significant differences in the percentages of neutrophil (%Neut), lymphocyte (%Lymph), and monocyte (%Mono) between the sexes (P>0.05). The average red blood cell count (RBC), hemoglobin concentration (HGB), hematocrit (HCT), platelet count (PLT), prothrombin time (PT), and activated partial thromboplastin time (APTT) were higher in male animals than in female animals (P<0.05). The average values of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), creatine phosphokinase (CK), lactate dehydrogenase (LDH), glucose (GLU), and triglyceride (TG) in male rats were higher than those in female rats (P<0.05). The urinary pH range for male animals was 5.0 to 8.5, while for female animals it was 6.5 to 9.0. The majority of male animals had a urinary specific gravity lower than 1.020, and the majority of female animals had a urinary specific gravity lower than 1.015. The weights of various organs (excluding the adrenal glands and reproductive organs) in male animals were heavier than those in female animals (P<0.001), while the organ/body weight ratios (excluding the kidneys and reproductive organs) of female animals were higher than those of male animals (P<0.001). ConclusionThis study summarizes the background reference ranges for body weight, food intake, hematology, and serum biochemistry indicators in SPF-grade SD rats in the untreated control group from six 90-day feeding trials conducted by the National Center for Safety Evaluation of Drugs. It provides important reference data for related research. By summarizing the background and spontaneous histopathological changes in rats, this study aids in the standardization and normalization of subsequent research, as well as in the evaluation and analysis of abnormal results.