Objective:To investigate the speech-evoked brainstem response (speech-ABR) of normal young people under different recording periods,which can provide the experimental evidences for researches on the stability of speech-ABR and promote its applications in clinical researches.Methods:40 healthy young people were randomly divided into two groups,which were tested following the same protocol at different time of two months interval.Latencies and amplitudes of the feature peaks in these groups were compared and the rates of appearance (detection rate) of the feature peaks were analyzed statistically.Results:Speech-ABRs were recorded successfully in two groups.The latencies and amplitudes of feature peaks in these groups were not different statistically,and the detection rates of V,A,C and F peaks were higher than others.Conclusion:The speech-ABRs of the two groups are stable,and the V,A,C and F peaks can be used as important indicators of clinical observation,showing that Speech-ABR is a promising tool in the study of Speech perception mechanism.

OBJECTIVE:To observe the efficacy and safety of Guizhi fuling capsule combined with leuprolide acetate in the treatment of endometriosis (EMS) after laparoscopicsurgery. METHODS:87 EMS patients were randomly divided into control group(44 cases)and observation group(43 cases). Control group received EMS resection under laparoscope,3.75 mg Leuprolide acetate for injection was given in the first day of postoperative first menstruation by intramuscular injection,once a day. Observa-tion group additionally received 0.93 g Guizhi fuling capsule,3 times a day. The treatment course for both groups was 6 months. Clinical efficacy,estradiol(E2),follicle stimulating hormone(FSH),luteinizing hormone(LH)and prolactin(PRL)levels before and after treatment,recurrence after 6 months and the incidence of adverse reactions in 2 groups were observed. RESULTS:The to-tal effective rate in observation group was significantly higher than control group,recurrence rate was significantly lower than con-trol group,the differences were statistically significant (P<0.05). Before treatment,there were no significant differences in E2, FSH,LH and PRL in 2 groups(P>0.05);after treatment,E2,FSH,LH and PRL in 2 groups were significantly lower than be-fore,and E2,FSH and LH in observation group were lower than control group,the differences were statistically significant (P<0.05),but there was no significant difference in PRL in 2 groups (P>0.05). And there was no significant difference in the inci-dence of adverse reactions in 2 groups (P>0.05). CONCLUSIONS:After laparoscope resection,Guizhi fuling capsule combined with leuprolide acetate can effectively improve efficacy,reduce sex hormone level and recurrence rate,and do not increase the inci-dence of adverse reactions in the treatment of EMS.

Objective To analyze ultrasonographic imaging feature of primary fallopian tube carcinoma (PFTC) and the reasons for misdiagnosis.Methods Clinical data and ultrasonographic imaging feature of 41 patients with pathologically confirmed PFTC were retrospectively analyzed from August 2008 to November 2016 in General Hospital of Chinese People's Liberation Army.Results Ultrasonographic characteristics of 41 PFTC cases:(1) Type Ⅰ (6 cases),the cystic adnexal mass with single or multiple papillary projections and circuity tubular structures,color Doppler flow imaging showed abundant blood flow signal inside the nipples.(2) Type Ⅱ (2 cases),the sausage shaped complex adnexal mass showed clear boundary,the cystic area that lined along the fallopian tube was around or at the side of the solid part,color Doppler flow imaging showed rich or abundant blood flow signal inside the solid part.(3) Type Ⅲ (13 cases),the sausage shaped hypoechoic adnexal mass showed clear boundary,color Doppler flow imaging showed rich or abundant blood flow signal inside the mass.(4) Type Ⅳ (14 cases),the single or multiple adnexal masses showed irregular surface,with predominant solid components,color Doppler showed rich or abundant blood flow signal inside the tumor;the normal ovarian structure was not detected in unilateral or bilateral adnexa area;and one or more signs of metastasis were found,such as the peritoneal thickening of vesicouterine pouch,uterine rectum pouch and omental,metastasis to other distant organs,and so on.(5) Type Ⅳ (6 cases),only hydrosalpinx or no abnormal ultrasonographic changes in the adnexal area.Nineteen (46.3％,19/41) cases were correctly diagnosed by preoperative ultrasonography,while 22 (53.7％,22/41)cases were missed or misdiagnosed.Conclusions Ultrasonography imaging of PFTC has certain characteristics,but it tends to be missed or misdiagnosis when the lesion is small.Ultrasound can show the location,size,internal echo,blood flow and distant metastasis of lesion,which can be taken as the first choice of imaging methods for preoperative diagnosis and postoperative follow-up of PFTC.

PURPOSE: Interleukin-17 (IL-17) is a proinflammatory cytokine that plays important roles in inflammation, autoimmunity, and cancer. The purpose of this study was to determine if IL-17 indirectly regulates macrophage differentiation through up-regulation of cyclooxygenase-2 (COX-2) expression in the cancer cell lines. MATERIALS AND METHODS: Human cervical cancer HeLa, human lung cancer A549, and mouse prostate cancer Myc-CaP/CR cell lines were treated with recombinant IL-17; Western blot analysis, enzyme-linked immunosorbent assay, and quantitative real-time polymerase chain reaction analysis were utilized to examine the cellular responses. RESULTS: IL-17 up-regulated expression of COX-2 mRNA and protein in HeLa, A549, and Myc-CaP/CR cell lines. IL-17's effects were mediated through nuclear factor-kappaB and ERK1/2 signaling pathways as the inhibitors of these pathways could inhibit IL-17-induced COX-2 expression. The conditional medium obtained from the cancer cells contained prostaglandin E2, the levels of which were increased by IL-17 treatment. When treated with the conditional medium, particularly with the IL-17-induced conditional medium, mouse RAW264.7 macrophages and human THP-1 monocytes expressed higher levels of IL-10 (a marker of M2 macrophages) than inducible nitric oxide synthase or tumor necrosis factor alpha (markers of M1 macrophages). In contrast, when RAW264.7 and THP-1 cells were treated directly with IL-17, expression of these marker genes was not markedly changed. CONCLUSION: The results of this study suggest that IL-17 indirectly promotes M2 macrophage differentiation through stimulation of the COX-2/PGE2 pathway in the cancer cells, thus IL-17 plays an indirect role in regulating the tumor immune microenvironment.
Animals ; Autoimmunity ; Blotting, Western ; Cell Line ; Cyclooxygenase 2 ; Dinoprostone ; Enzyme-Linked Immunosorbent Assay ; Humans ; Inflammation ; Interleukin-10 ; Interleukin-17* ; Lung Neoplasms ; Macrophages* ; Mice ; Monocytes ; Nitric Oxide Synthase Type II ; Prostatic Neoplasms ; Real-Time Polymerase Chain Reaction ; RNA, Messenger ; Tumor Microenvironment ; Tumor Necrosis Factor-alpha ; Up-Regulation ; Uterine Cervical Neoplasms

Objective To explore the feasibility of robot-assisted laparoscopic inferior vena cava (IVC) thrombectomy in treating renal tumor with Mayo level Ⅲ-Ⅳ inferior vena cava thrombus.Methods From November 2014 to January 2017,5 cases of renal tumor with Mayo level Ⅲ-Ⅳ inferior vena cava tumor thrombus were treated with robot-assisted surgery.There were 4 males and 1 female with the median age of 59 years (range 54-71 years).Four cases had the renal tumor on the right side and one on the left side.The mean tumor size was 6.8 cm (range 5-9 cm) with 3 cases of T3b and 2 cases of T3c.There were 4 cases of level Ⅲ and 1 case of level Ⅳ inferior vena cava thrombus with the median length of 9 cm (range 7-11 cm).The surgical procedure for Mayo level Ⅲ inferior vena cava thrombus included mobilization of both left and right robes of liver,subsequently controlling the suprahepatic infradiaphramatic IVC and first porta hepatis simultaneously.The surgical procedure for Mayo level Ⅳ inferior vena cava thrombus included cardiopulmonary bypass by multi-disciplinary cooperation among urologists,hepatobiliary and cardiovascular surgeons.The procedures included live mobilization,control of the superior vena cava and first porta hepatis and remove thrombus in the atrium and IVC respectively.Results All operations were completed successfully.The median operative time was 440 min (320-630 min).The blood recovery device was used and the intraoperative estimated blood loss was 2 500 ml (500-6 000 ml) and all cases required intraoperative blood transfusion.The median time of intraoperative occlusion of IVC was 35 min (25-50 min).All patients were transferred to the intensive care unit for median of 4 days (2-8 days) after surgery.The median time to remove the postoperative drainage tube was 9 days (7-12 days).Postoperative pathological diagnosis revealed 5 cases of clear cell carcinoma.Postoperative renal dysfunction occurred in 3 patients and liver dysfunction occurred in 2 patients who improved after medical therapy.During median 19.6 months (12-48 months) of follow-up,1 patient died and 1 patient progressed.Conclusions Despite the high risk of surgery,robot-assisted laparoscopic IVC thrombectomy for renal tumor with Mayo level Ⅲ-Ⅳ thrombus is feasible for experienced surgeons in selected patients.However,the oncological outcomes need further investigation.

We reported a case of monochorionic monoamniotic twins discordant for anencephaly diagnosed by second-trimester ultrasonography at the First Affiliated Hospital of Fujian Medical University.Ultrasound at seven weeks of gestation showed only one gestational sac with an embryo inside.Another 12 gestational weeks' ultrasound scan performed at another hospital found one gestational sac and one fetus (crown-rump length was 6.11 cm and nuchal translucency was 0.11 cm) in the upper-middle uterine cavity.The ultrasound examination at 22+6 gestational weeks identified one placenta and two fetuses without obvious diaphragm echo in between.Although no structural abnormality was observed in one fetus,frog-like eyes,absence of skull image and brain tissue echo were presented in the other fetus.The patient was transferred to a higher level hospital and was successfully performed radiofrequency ablation for selective reduction at 23+4 weeks of gestation.At 35 weeks,a premature live boy and an anencephalic stillbirth fetus were born vaginally after premature rupture of membranes.The baby boy was healthy at follow-up at four months old.

Objective:To retrospectively analyze clinical efficacy and safety of omalizumab in the treatment of chronic urticaria (CU) in southern Zhejiang, China.Methods:A retrospective observational study was conducted on CU patients who received omalizumab treatment at the First Affiliated Hospital of Wenzhou Medical University from January 1st, 2018 to August 1st, 2021. Through the outpatient follow-up visits, the disease activity, condition control, and quality of life were evaluated using the 7-day urticaria activity score (UAS7) , urticaria control test (UCT) , and dermatology life quality index (DLQI) . In addition, changes in disease condition, recurrence after withdrawal, and adverse events were assessed. Independent-sample t test was used for intergroup comparisons of normally distributed measurement data, Wilcoxon signed-rank sum test or Kruskal-Wallis H test was used for comparisons of non-normally distributed measurement data, and chi-square test or Fisher′s exact test was used for comparisons of enumeration data. Results:A total of 252 CU patients with poor response to antihistamines were included, with a baseline UCT score of 5.0 ± 2.4 points, a UAS7 score of 25.6 ± 6.2 points, and a DLQI score of 17.5 ± 4.7 points; among them, 204 (81.0%) were treated with omalizumab at an initial dose of 300 mg, and 48 (19.0%) with omalizumab at an initial dose of 150 mg. At the end points (12.0 ± 1.4 months after the start of treatment) , an overall control rate of 90.3% (224/248) was achieved after the omalizumab treatment; concretely, 137 (55.2%) patients achieved complete control (UCT = 16 points) , 87 (35.1%) achieved partial control (12 points ≤ UCT < 16 points) , and 24 (9.7%) showed no response (UCT < 12 points) , while 10 with partial response shifted to complete control after dose increase. During the treatment period, recurrence occurred in 50 patients (36.5%) , of whom 32 patients opted for retreatment with omalizumab, and then 30 (93.8%) achieved partial or complete control. Adverse events were reported in 8 patients (3.2%) , and all were mild or moderate.Conclusion:Omalizumab was effective in the real-world treatment of CU, and could improve patients′ quality of life, with a favorable safety profile.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective:To explore the feasibility and safty of robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy in treatment of Ⅳa grade tumor thrombus without cardiopulmonary bypass and thoracotomy.Methods:The clinical data of 4 patients with renal cell carcinoma and Ⅳa grade tumor thrombus by robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy from January 2013 to June 2019 were retrospectively analyzed. The median age was 53.5 (53-70) years. The average body mass index was 23.25 (20.7-26.3) kg/m 2. The tumors were located on the right side in 2 cases. The average maximum diameter of the tumor was 8.1 (3.6-11.2) cm.Preoperative tumor thrombus of all patients was classified as Ⅳa. The average preoperative length of tumor thrombus in vena cava was 12.3 (11.8-18.0) cm. All the operations were performed under multidisciplinary cooperation of urology, hepatobiliary, cardiovascular, ultrasound and anesthesiologist team. Surgical procedure: Robot assisted liver mobilization was used to expose the inferior vena cava. Under the guidance of intraoperative ultrasound, the central tendon and pericardium of diaphragm were dissected until the inferior vena cava and right atrium in the superior pericardium were exposed. The first porta hepatis and inferior vena cava were blocked in turn.The vena cava thrombectomy and inferior vena cava reconstruction were performed. Results:All the operations were completed without conversion. The median operation time was 553.5 (338-642) minutes, and the median time of the first porta hepatis occlusion was 18.1 (14-32)minutes. The median blood loss was 1 900(1 000-2 600)ml. All patients were transferred to ICU after operation. The median length of stay in ICU was 7(4-8) days, and the median time of indwelling drainage tube was 8(4-12) days. The average postoperative hospital stay was 13(11-20) days. There were 1 case of grade Ⅱ and 3 cases of grade Ⅲ complications (Clavien classification). One case had paroxysmal supraventricular tachycardia, one case had lymphatic fistula, one case had pleural effusion with atelectasis, and one case had hepatic and renal insufficiency and lymphatic fistula. The complications were improved after treatment. There was no perioperative death.Conclusions:Robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy is an alternative method for the treatment of Ⅳa grade inferior vena cava tumor thrombus. Using this method, Ⅳa grade tumor thrombus can be treated without cardiopulmonary bypass and thoracotomy, with controllable complications and zero perioperative mortality.

Objective:To explore the clinical efficacy and safety of different surgical procedures of Mayo level Ⅳ inferior vena cava tumor thrombus(IVC-TT).Methods:The clinical and pathological data of 36 patients with Mayo level Ⅳ tumor thrombus were collected in three large clinical centers in China, including 18 cases in PLA General Hospital, 7 cases in Nanfang Hospital, and 11 cases in Renji Hospital. There were 25 males and 11 females.The median age was 56.5 years (53-67 years old). The average body mass index was 24.18±2.55 kg/m 2. The average diameter of renal tumors was 8.24±3.25 cm. The average length of inferior vena cava tumor thrombus was 12.89±2.50 cm. Mayo level Ⅳ tumor thrombus were divided into level Ⅳa and level Ⅳb (301 classification) based on the criterion of whether the proximal end of the thrombus has invaded the right atrium. Among them, level Ⅳa patients underwent robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass(CPB-free group, 6 cases). Level Ⅳb patients underwent robot-assisted inferior vena cava thrombectomy with cardiopulmonary bypass(CPB group, 12 cases) or cardiopulmonary bypass with deep hypothermic circulatory arrest assisted inferior vena cava thrombectomy(CPB/DHCA group, 18 cases). The baseline data of the three groups of patients were comparable. The perioperative results and long-term survival data after surgery were compared with different surgical methods for grade Ⅳcancer thrombosis. Results:All operations were successfully completed. Compared with the CPB group, the CPB-free group had a shorter first portal blocking time[17.5(15-36)min vs. 36.5(12-102)min, P=0.044], less intraoperative bleeding [2 350(1 000-3 000)ml vs. 3 500 (1 500-12 000)ml, P=0.043] and a lower allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 185(700-5 800)ml, P=0.049]. Compared with the CPB/DHCA group, the CPB-free group had an advantage in reducing intraoperative allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 700(1 200-10 000)ml, P=0.003]. There were no significant differences between groups in terms of duration of surgery and postoperative hospital stay. Among the 36 patients in this group, 23(64%) developed major complications (level Ⅲ or above), including 9 (25%) grade Ⅲ, 12 (33%) grade Ⅳ, and 2 (6%) grade Ⅴ. The CPB-free group had a relatively low complication rate of grade Ⅳ or above [ 17% (1/6) vs.42% (5/12) vs.44% (8/18)]. There were no statistical differences in median progression-free survival (16.4 vs.12.3 vs.18.0 months, P=0.695) and overall survival (30.1 vs.30.2 vs.37.7 months, P=0.674) between the groups. Conclusions:Robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass has the advantages of short ischemia time of organs, less intraoperative bleeding, and low incidence of major complications, which can be used as a safe and feasible surgical strategy for selected level Ⅳ tumor thrombus.