1.Therapeutic Effect Observation on Treatment of Acne with Acupuncture plus Moving Cupping and Blood-letting
Qifang WANG ; Guoyan WANG ; Chouping HAN
Journal of Acupuncture and Tuina Science 2008;6(4):212-214
Objective: To observe the therapeutic effect on treatment of acne with acupuncture plus moving cupping and blood-letting. Method: Sixty acne cases were randomized into the treatment group for combined acupuncture and moving cupping and blood-letting and control group for acupuncture alone. The therapeutic effects of the cases in the two groups were observed after a 30-day treatment. Result: The total effective rate was significantly higher in the treatment group than in the control group (P<0.05). Conclusion: The combined acupuncture and moving cupping and blood-letting can effectively increase the effective rate in the treatment of acne.
2.Comparison of four score modes in prognosis assessment of AECOPD patients with respiratory failure
Qifang SHI ; Ying SHENG ; Shuyun WANG
The Journal of Practical Medicine 2017;33(2):242-245
Objective To explore the predictive effect of modified DECAF,DECAF,CAPS and APACHEⅡin the assessment of prognosis of AECOPD patients with respiratory failure. Methods Clinical data of 186 AECOPD cases complicated with respiratory failure were analyzed and four score modes were used within 24 hours of admission. Clinical endpoints were patients′ survival status 28 days after admission. The discriminative power of the four score modes was evaluated by the area under the receiver operating characteristic curve (AUC). Results AUC of the modified DECAF(0.777,95%CI:0.710-0.835) and DECAF (0.766,95%CI:0.699-0.825) for prognosis was significantly greater than that of CAPS(0.699 ,95%:0.628-0.764) and APACHEⅡ(0.715,95%:0.645-0.779). Conclusion The modified DECAF and DECAF have predictive values on assessing the prognosis of AECOPD patients with respiratory failure ,which are simple and efficient.
3.Analysis of the relationship between clinicopathological features and pelvic lymph node metastasis in patients with early stage squamous cell carcinoma of the uterine cervix
Qifang TIAN ; Xinyu WANG ; Weiguo LU ; Feng YE ; Xing XIE
Chinese Journal of Obstetrics and Gynecology 2008;43(10):760-763
Objective To evaluate clinical and pathologic factors associated with pelvic lymph node metastasis in patients with early-stage squamous cell carcinoma of the uterine cervir.Methods From February 2004 to January 2007,135 patients with stage Ⅰ b-Ⅱ a cervical squamous cell carcinoma in Women's Hospital,School of Medicine,Zhejiang University,were retrospectively studied.The relationship between pelvic lymph node metastasis and age,clinical stage,tumor size,grade of differentiation,depth of muscular invasion,lymphatic vascular space invasion,pretreatment level of serum squamous cell carcinoma antigen,pretreatment plasma level of fibrinogen,pretreatment leveh of hemoglobin and platelet were evaluated by univariate and multivariate analyses.Results Totally 3996 lymph nodes were dissected in 135 patients,with an average of 29.6 lymph nodes in each patient.12.6%of the patients(17/135)had metastasized pelvic lymph nodes.Univariate analysis indicated that tumor size(P=0.003),depth of muscular invasion(P=0.004),vasular space invasion(P<0.01),pretreatment levels of platelet(P=0.006)and fibrinogen(P<0.01)were significantly related to pelvic lymph node metastasis.Multivariate logistic regression analysis showed that lymphatic vascular space invasion(OR:3.674,95%CI:1.825-7.393,P<0.01)and pretreatment plasma level of fibrinogen(OR:4.568,95%CI:1.779-11.725,P=0.002)were significantly related to pelvic lymph node metastasis in patients with early-stage squamous cell carcinoma of the uterine cervix.Conclusion In early-stage cervical squamous cell carcinoma,lymphatic vascular space invasion and higher pretreatment plasma levels of fibrinogen are risk factors of pelvic lymph node metastasis.
4.Modulating drug loading and release profile of beta-cyclodextrin polymers by means of cross-linked degree.
Qifang WANG ; Sanming LI ; Yuyang ZHANG ; Hong ZHANG
Acta Pharmaceutica Sinica 2011;46(2):221-6
The purpose of the present study is to use beta-cyclodextrin polymers (beta-CDP) with different cross-linked degree (CLD) to form inclusion complexes with ibuprofen and examine the effects of structural and compositional factors of beta-CDP on its drug loading and release behaviors. A series of beta-CDP with different CLD were synthesized and characterized by Fourier Transform Infrared Spectroscopy (FT-IR) and 13C NMR spectrum. The beta-CDP was systemically characterized for the relation between the CLD of beta-CDP and the drug loading and release as well. The results of FT-IR and 13C NMR showed that similar peak-shaped vibration of beta-CDP and beta-CD implies that the polymer keeps the original characteristic structure of beta-CD. The CLD of the beta-CDP played a critical role in the drug loading and release, increasing the CLD resulted in reduction of drug loading, but increase in drug release.
5.Kinetic study on dissociation of amylose/salicylic acid compound using non-isothermal method
Qifang WANG ; Sanming LI ; Xin CHE ; Chaojie LI
Acta Pharmaceutica Sinica 2010;45(7):909-13
The inclusion compound of amylose and salicylic acid (SA) was prepared by a sealed temperature control method, and the formation of the inclusion compound was confirmed by IR spectrum and powder X-ray diffraction. The kinetic parameters of dissociation of amylose/SA compound were studied by the nonisothermal method which was defined as a relationship between the dissociation ratio and time. The values of activation energy (Ea) and frequency factors (InA) were calculated by a nonlinear least-square method. In this study, the formation of the inclusion compound of amylose/SA was confirmed by IR spectrum powder X-ray diffraction. SA existed in a molecule form in the spiral stouction of amylose. The dissociation of amylose/SA compound was attributed to first order reaction. The values of Ea calculated by the nor-isothermal method were 21.71 and 22.41 kJ x mol(-1) at heating rate 5 and 10 degrees C x h(-1), respectively. The corresponding isothermal method value of Ea was 22.17 kJ x mol(-1); the calculated InA values were 9.32 and 10.08 at heating rate 5 and 10 degrees C x h(-1), respectively. The corresponding isothermal method lnA value was 9.26. The results were in good agreement with Ea values and lnA values by isothermal method. These results indicated that the non-isothermal method described in this study could be adequately used for the stability study of inclusion compound and was a rapid and accurate method for the determination of kinetic parameters.
6.Characteristics of Dynamic Contractions on Surface Electromyography Single of Stroke Patients Induced from Low Limb Muscle When Exercising Passively, Exercising Initiatively with Assitant and Against Resistance
Yanquan TAN ; Huihan DAI ; Yi LIN ; Qifang CAI ; Jian WANG
Chinese Journal of Rehabilitation Theory and Practice 2009;15(4):348-351
Objective To investigate the characteristics of the dynamic contractions on the surface electromyography (sEMG) single of stroke patients induced from the low limb muscle when exercising passively, exercising initiatively with assistant and against resistance.Methods 24 stroke patients with hemiplegia and 17 normal subjects were tested with sEMG under a dynamic contractions in coxa and knee flexion and extension passively, initiatively with assistant and against resistance. The myoelectric signals were collected and processed by linear time and frequency domain method.Results The values of median frequency (MF) and mean power frequency (MPF) of stroke group were significantly lower, but the value of average EMG (AEMG) was higher ( P<0.001). The values of MF and MPF in activity side were lower than that in non-activity side ( P<0.001). The values of MF and MPF when exercising passively were higher than that when exercising with resistance ( P<0.05). The value of AEMG when exercising with resistance was highest. The values of MF and MPF in the synergist muscle were higher. The values of AEMG in the antagonistic muscle and synergist muscle were higher than that agonist and synergist muscle ( P<0.01). The values of MF and MPF in non-paretic exercising side were higher significantly, but in paretic exercising side and non-paretic silent side were lower. The values of MF and MPF in exercising side from vastus lateralis (VL) were the highest. The values of AEMG in exercising side and non-exercising side from biceps femoris (BF) were the highest. The values of MF and MPF in low limb of stroke group reduced, that in rectus femoris (RF) from paretic side was the lowest; that in BF from non-paretic side was the lowest ( P<0.01). The value of AEMG in low limb of stroke group was high significantly, especially in BF from the low limb of the non-paretic side in stroke patients. The values of AEMG in four group muscles gradually were higher following the higher exercising load, and that in the BF was the highest, and that in vastus medialis (VM) rose significantly.Conclusion The values of MF and MPF of stroke patients with hemiplegia reduce significantly, but the value of AEMG is higher. The values of MF and MPF in exercising side are lower than that in non-exercising side and non-paretic exercising side rising significantly, but that in paretic exercising side and non-paretic silent side reduce significantly. The values of MF and MPF in assistant exercise are higher than that in passive exercise and resistance exercise, but the value of AEMG in resistance exercise is higher than that in assistant exercise and in passive exercise. The values of MF and MPF in synergist muscle rise, but the values of AEMG in antagonist and synergist muscle are higher than that agonist and synergist muscle.
7.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
8.Chemical constituents of lateral roots of Aconitum carmichaelii Debx.
Jing ZHANG ; Guibo SUN ; Qifang LEI ; Guangzhi LI ; Junchi WANG ; Jianyong SI
Acta Pharmaceutica Sinica 2014;49(8):1150-4
In order to find the cardiotonic constituents of lateral roots of Aconitum carmichaelii Debx., the investigation was carried out. Silica gel column chromatography, Sephadex LH-20, medium-pressure MCI and reverse phase ODS column chromatography were used to separate the 90% EtOH extract of the lateral roots of Aconitum carmichaelii Debx. The structures of the isolated compounds have been identified by chemical properties and spectroscopic analyses. Ten compounds were isolated and their structures were elucidated as benzoic acid-5-hydroxy-2-benzoyl-amino methyl ester (1), honokiol (2), pinoresinol (3), salicylic acid (4), p-hydroxy-cinnamic acid (5), songorine (6), karakoline (7), mesaconitine (8), hypaconitine (9) and 14-benzoylhypaconitine (10), separetely. Compound 1 is a new compound and its structure has been established by NMR, HR-ESI-MS, UV, IR and X-Ray. Compound 2-5 are isolated from the lateral roots of Aconitum carmichaelii Debx. for the first time.
9.The relationship between isolated nocturnal hypertension and left ventricular hypertrophy
Lu LU ; Yan LI ; Qifang HUANG ; Lihua LI ; Changsheng SHENG ; Jiguang WANG
Chinese Journal of Internal Medicine 2008;47(10):819-822
Objective To investigate the relationship between isolated nocturnal hypertension and left ventricular hypertrophy. Methods In the inhabitants of 14 villages in Jingning County, Zhejiang Province, we performed 24-hour ambulatory blood pressure monitoring with SpaceLab monitors and measured 12-lead resting electrocardiogram using an electronic recording system of GE company, Left ventrieular hypertrophy was diagnosed with the criteria of Sokolow-Lyon voltage amplitude and Cornell product. Isolated nocturnal hypertension was defined as a nighttime ( from 22:00 to 4:00) blood pressure of ≥ 120/70 mm Hg( 1 mm Hg = 0. 133 kPa). Isolated daytime ( from 8:00 to 18:00) hypertension was a diurnal blood pressure of ≥ 135/85 nun Hg. When both conditions were present or absent, subjects were classified either as having combined day-night hypertension or as normotensive on ambulatory measurement. Analysis of variance and multiple regressions were used for statistical analysis. Results 647 participants (53.9% being female,average age 47. 8 years) included 72 patients with isolated nocturnal hypertension, 33 with isolated daytime hypertension and 248 with day-night sustained hypertension. Compared with normotensive subjects, patients with isolated nocturnal hypertension and day-night sustained hypertension had a higher Sokoiow-Lyon voltage amplitude and Comell product. However, after adjustment for sex, age, body mass index, drinking and smoking habits, serum total cholesterol, fasting blood glucose and the use of antihypertensive drugs, only day-night hypertensive patients had a significantly higher Sokolow-Lyon voltage (32. 8 mV, P =0. 0003 ) and Cornell product (1371 mV×ms, P =0.0004) than normotensive subjects (29.0 mV, 1114 mV×ms).Regardless of whether Sokolow-Lyon or Cornell criteria were used, both nighttime and daytime systolic and diastolic blood pressure were independent risk factors of left ventricular hypertrophy (P < 0. 01 ). However,the prevalence of left ventricular hypertrophy in patients with isolated nocturnal hypertension ( 23.6% ) study was not statistically different from that in normotensives ( 17.4%, P = 0. 24). Conclusion In our current cross-sectional study, isolated nocturnal hypertension was not independently related to left ventricular hypertrophy diagnosed with ECG criteria.
10.Clinical significance of HPV L1 capsid protein detection in cervical exfoliated cells in high-risk HPV positive women
Jiajian WANG ; Qifang TIAN ; Su ZHANG ; Liping LYU ; Jie DONG ; Weiguo LYU
Chinese Journal of Obstetrics and Gynecology 2015;(4):253-257
Objective To explore the clinical significance of human papillomavirus L1 capsid protein detection in cervical exfoliated cells in high-risk HPV positive women. Methods From November 2012 to June 2013,386 high-risk HPV positive (detected by hybrid capture Ⅱ) cases were enrolled as eligible women from Huzhou Maternity&Child Care Hospital and Women′s Hospital,School of Medicine, Zhejiang University. All eligible women underwent liquid-based cytology (ThinPrep) followed by colposcopy. Biopsies were taken if indicated. Cervical exfoliated cells were collected for HPV L1 capsid protein detection by immunocytochemistry. Expression of HPV L1 capsid protein in groups with different histological diagnosis were compared, and the role of HPV L1 capsid protein detection in cervical exfoliated cells in cervical lesions screening was accessed. Results Total 386 enrolled eligible women were finally diagnosed histologically as follwed:162 normal cervix, 94 low-grade squamous intraepithelial lesion (LSIL), 128 high-grade squamous intraepithelial lesion (HSIL) and 2 squamous cervical cancer (SCC). The positive expression rate of HPV L1 in HSIL+(HSIL or worse) group was significantly lower than that in LSIL-(LSIL or better) group (19.2% vs 66.4%,P=0.000). While identifying HSIL+ in HPV positive cases and compared with cytology, HPV L1 detection resulted in significant higher sensitivity (80.77%vs 50.77%,P=0.000) and negative predictive value (NPV;87.18% vs 76.47%,P=0.004), significant lower specificity (66.41% vs 81.25%,P=0.000),and comparable positive predictive value (PPV;54.97% vs 57.89%, P=0.619). To identify HSIL+in HPV-positive/cytology-negative women, the sensitivity, specificity, PPV, and NPV of HPV L1 detection were 87.50%, 61.54%, 41.18%, and 94.12%respectively, while 80.00%, 86.36%, 80.00%and 86.36%respectively in HPV-positive/atypical squamous cell of undetermined significance(ASCUS)women. Conclusions HPV L1 capsid detection in cervical exfoliated cells have a role in cervical lesions screening in high-risk HPV positive women, and may be a promising triage for high-risk HPV-positive/cytology-negative or ASCUS women.