Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P＜0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P＜0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P＜0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P＜ 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.

Accidents, Occupational ; statistics & numerical data ; Adolescent ; Adult ; Aged ; Female ; Follow-Up Studies ; Hand Injuries ; epidemiology ; etiology ; Humans ; Male ; Middle Aged ; Prognosis ; Retrospective Studies ; Young Adult

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective To evaluate the effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion (I/R ) in rats .Methods One hundred and forty-four adult male Sprague-Dawley rats ,weighing 400-500 g ,were randomly divided into 3 groups ( n=48 each) using a random number table:sham operation group (group S ) , I/R group and electro-acupuncture pretreatment group (group EA) .Global cerebral I/R was induced by 4-vessel occlusion method .Bilateral vertebral arteries were permanently occluded by cauterization and bilateral carotid arteries were occluded for 5 min , followed by reperfusion .Electro-acupuncture of Dazhui and Baihui acupoints lasting for 30 min was performed once a day for 5 consecutive days starting from 5 days before ischemia in group EA .At 6 ,12 ,24 and 48 h of reperfusion ,12 rats were sacrificed in each group and hippocampi were removed for microscopic examination and for determination of apoptosis rate (by TUNEL ) and expression of growth arrest-and DNA damage-inducible gene 153 (GADD153 ) protein (by Western blot ) .Results Compared with group S ,the apoptosis rate was significantly increased and the expression of GADD153 protein was up-regulated at 6 ,12 ,24 and 48 h of reperfusion in I/R and EA groups ( P<0.05) .Compared with group I/R ,the apoptosis rate was significantly decreased and the expression of GADD 153 protein was down-regulated at 6 ,12 ,24 and 48 h of reperfusion in group EA ( P< 0.05) .The pathological changes were significantly attenuated in group EA as compared with group I/R .Conclusion Electro-acupuncture pretreatment can down-regulate the expression of GADD 153 protein , reduce endoplasmic reticulum stress , and decrease cell apoptosis ,thus attenuating global cerebral I/R injury in rats .

Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7％ (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9％) Gps made the diagnosis based on history and physical examination,171 (44.4％)Gps never used BNP or NTPro-BNP tests,280 (72.7％)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3％)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10％-30％ in 284 (73.8％) Gps,149 (38.7％) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1％) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9％)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10％-30％ in 330 (85.7％) Gps,258 (67.0％) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3％)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4％)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.

Objective To investigate the clinical efficacy of ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for the elderly patients with acute calculous cholecystitis.Methods The clinical data of 35 elderly patients with cholecystolithiasis who were admitted to the General Hospital of Chengdu Military Command from January 2012 to December 2013 were retrospectively analyzed.All the 35 patients received ultrasound-guided double-tract percutaneous drainage,and then received choledochoscopic gallbladder-preserving cholecystolithotomy.The long-term oral use of anti-inflammatory and cholagogue medications after operation reduced recurrence of cholecystolithiasis.All the patients were followed up by telephone interview and outpatient examination till June 30,2014.Results All the 35 patients undergoing successfully the ultrasound-guided double-tract percutaneous cholecystostomy.Of the 35 patients,1 patient with the puncture bleeding was cured successfully by symptomatic treatment,1 patient was treated by cholecystectomy due to the unformed sinus tract under costal margin,and other 34 patients underwent successfully cholecystolithotomy.The follow-up was carried out for 4 to 24 months and 1 patient was diagnosed as with recurrence of cholecystolithiasic.Conclusion Ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for elderly patients with acute calculous cholecystitis is safe and feasible,with an advantage of promotional value.

Objective To determine the prevalence and clinical features of peripancreatic vascular abnormalities in patients with pancreatitis.Methods The clinical data of 102 pancreatitis patients between January 2013 to December 2014 in the General Hospital of Shenyang Military Command who underwent contrast enhanced CT or contrast enhanced MRI scans were retrospectively analyzed.The radiological features of peripancreatic vascular abnormalities in such patients were examined, and the clinical features of pancreatitis patients with or without peripancreatic vascular abnormalities were investigated.Results Peripancreatic vascular abnormalities were found in 18 patients(17.6%), and vascular abnormalities were relatively common in portal vessels.No significant differences were observed on the age at onset, gender ratio, smoking status, alcohol consumption and length of stay between patients with and without peripancreatic vascular abnormalities.Compared with those without peripancreatic vascular abnormalities, patients with peripancreatic vascular abnormalities had a significantly higher incidence of peripancreatic fluid collection, pancreatic pseudocyst and gastric varices, and the differences were statistically significant(all P<0.05).Conclusions Peripancreatic vascular abnormalities can be complicated with pancreatitis.Enhanced CT or enhanced MRI were valuable in the diagnosis.Pancreatic pseudocyst, peripancreatic fluid collection and gastric varices were more common in pancreatitis complicated with peripancreatic vascular abnormalities.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.