1.New advances in perioperative fluid management in lung transplantation
Meng SUI ; Murong HUANG ; Ranming MA ; Mochi WANG ; Chunxiao HU
Organ Transplantation 2025;16(4):648-652
Lung transplantation is an effective treatment for various end-stage lung diseases. Optimizing perioperative fluid management can reduce the incidence of postoperative pulmonary edema and improve the prognosis of lung transplant recipients. Excessive fluid administration may lead to pulmonary edema, ischemia-reperfusion injury of the transplant lung, and increased cardiac burden, which can induce heart failure. On the other hand, overly strict fluid restriction may lead to hypovolemia, affecting tissue perfusion and causing organ dysfunction. Therefore, precise regulation of fluid balance is crucial for the postoperative recovery of lung transplant recipients. This article reviews the physiological characteristics of lung transplant recipients, types of infused fluids, fluid therapy regimens, and hemodynamic monitoring, aiming to elucidate the particularities of perioperative fluid management in lung transplantation and provide new ideas and directions for individualized fluid management.
2.Analysis on medical visit behaviors of outpatients in a specialized hospital based on Boruta algorithm
Qian SHAO ; Lei WANG ; Geng ZHOU ; Lei LI ; Murong ZOU ; Hao ZHENG ; Chenjie SHAO
Chinese Journal of Hospital Administration 2024;40(6):431-437
Objective:To analyze the preferences of outpatients in a tertiary public specialized hospital, for references for optimizing the allocation of outpatient medical resources, and enhancing the medical experience.Methods:This study used convenience sampling method to select outpatients from a tertiary public stomatological hospital from January to September 2022 as the survey subjects, and conducted a questionnaire survey. The questionnaire mainly included gender, age, place of residence, education level, and medical needs, etc. Logistic regression model and Boruta algorithm were used to analyze the factors influencing patients′ preferred tertiary public specialized hospitals for treatment.Results:A total of 19 255 patients were included in this study. 13 558 patients (70.41%) preferred tertiary public specialized hospital for treatment, including 9 715 patients (71.65%) aged 21 to 45, 1 015 local patients (73.87%), 8 278 patients (61.05%) who chose treatment options, and 6 442 patients (47.51%) who came to the hospital for medical insurance reimbursement. By logistic regression analysis, age, residence, education level, medical needs, oral health habits, access to oral health knowledge, pre interview experience of Internet hospitals, monthly income, number of family members and reasons for seeking medical treatment were the influencing factors of patients′ preference for tertiary public specialized hospitals. According to the Boruta algorithm analysis, the top 6 important factors were the reasons for seeking medical treatment (Z=126.66), oral health habits (Z=96.44), access to oral health knowledge (Z=66.91), medical needs (Z=62.21), age (Z=57.54), and residence (Z=55.21).Conclusions:Local patients and young and middle-aged patients tended to choose tertiary public specialized hospitals for treatment, and treatment projects were the main business types that attract patients to visit tertiary public specialized hospitals. There were many important influencing factors for patients choosing tertiary public specialized hospitals for treatment, including the reasons for seeking medical treatment, oral health habits, access to oral health knowledge, and medical needs.
3.Preliminary study on the existing problems in health economic evaluation study of acupuncture in China.
Hui WANG ; Si-Qi LI ; Zhi-Miao MURONG ; Xiao-Nong FAN
Chinese Acupuncture & Moxibustion 2022;42(6):691-695
The literature of health economic evaluation study in the field of acupuncture in China was systematically summarized and analyzed, and the existing problems in the current research were discussed from the aspects of research perspective, cost calculation scope, data analysis method selection. Moreover, the key points of the health economic evaluation research were summarized, and the research objectives, the relationship between the expected research results and data analysis methods and the process of thinking were sorted out, and several suggestions for research report writing were proposed, aiming to provide a reference for the quality improvement of the acupuncture health economic evaluation research in China.
Acupuncture
;
Acupuncture Therapy
;
China
;
Cost-Benefit Analysis
;
Publications
4.Quality control in the implementation of multi-center acupuncture clinical trial.
Si-Qi LI ; Zhi-Miao MURONG ; Hui WANG ; Xiao-Nong FAN
Chinese Acupuncture & Moxibustion 2022;42(3):321-324
The paper introduced the experiences of quality management in the implementation of multi-center acupuncture clinical trials and the keys in training acupuncture operators. The process management was explained in view of the division of labor for researchers, protocol learning and the communication among sub-centers. Besides, specificity links of acupuncture research were summarized, i.e. meaning implementation brief of acupuncture operation training, control for quantity of stimulus in acupuncture and doctor-patient communication. It is anticipated to provide a valuable reference for the quality control and improvement of multi-center acupuncture clinical trial in future.
Acupuncture Therapy
;
Clinical Trials as Topic
;
Humans
;
Multicenter Studies as Topic
;
Quality Control
5.Criteria of "arrival of
Cui-Cui TIAN ; Liang YU ; Zhi-Miao MURONG ; Shu-Xin WANG ; Xiao-Nong FAN
Chinese Acupuncture & Moxibustion 2021;41(6):666-670
From "arrival of
Acupuncture
;
Acupuncture Points
;
Acupuncture Therapy
;
Qi
;
Sensation
6.Ulinastatin can reduce the inflammation response after laparoscopic colectomy:a propensity score match-ing study
Yonggang WANG ; Murong HE ; Chunshui LIN
The Journal of Practical Medicine 2018;34(12):2053-2057
Objective To investigate the effect of ulinastatin on postoperative clinical outcomes in pa-tients undergoing elective laparoscopic colectomy. Methods 454 patients underwent elective laparoscopic colecto-my from January 2015 to September 2017 were included in this retrospective study. Patients were divided into 2 groups:ulinastatin group and control group. Propensity score matching was applied to balance the preoperative baseline differences between 2 groups. 155 patients in each group were successfully matched. Mixed linear model was used to exam the effect of ulinastatin on various clinical indicators within 3 days after the surgery,including in-flammation indicators(white blood cell counts,C reactive protein),liver function indicators(alanine transami-nase,aspartate transaminase,total bilirubin),renal function indicators(serum creatinine,blood urea nitrogen). Postoperative hospital length of stay was compared between 2 groups using student's t-test. Results Ulinastatin group showed significantly reduced postoperative white blood cell count and ? reactive protein level (P = 0.036 and 0.025)compared with the control group. The average mean inhibitory effects were 1.04×109/L and 23.93 mg/L respectively,which was 11.1% and 29.9% lower than that of the control group. Procalcitonin,transaminases,total bilirubin,serum creatinine,blood urea nitrogen levels and postoperative hospital length of stay showed no signifi-cant difference between the two groups(P > 0.05). Conclusion Ulinastatin can significantly reduce the level of inflammation response after laparoscopic colectomy,which is beneficial to the fast recovery.
7.New Insights into Genotype-phenotype Correlations in Chinese Facioscapulohumeral Muscular Dystrophy: A Retrospective Analysis of 178 Patients.
Feng LIN ; Zhi-Qiang WANG ; Min-Ting LIN ; Shen-Xing MURONG ; Ning WANG
Chinese Medical Journal 2015;128(13):1707-1713
BACKGROUNDFacioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling.
METHODSHere, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses.
RESULTSWe observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members.
CONCLUSIONSAlthough the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.
Adolescent ; Adult ; Asian Continental Ancestry Group ; genetics ; Child ; Child, Preschool ; Female ; Genetic Association Studies ; Humans ; Male ; Middle Aged ; Muscular Dystrophy, Facioscapulohumeral ; genetics ; pathology ; Phenotype ; Retrospective Studies ; Young Adult
8.Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative
Qifang LIN ; Wanjin CHEN ; Ning WANG ; Zhiying WU ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2011;44(8):568-573
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
9.Mutation analysis of senataxin gene in sporadic amyotrophic lateral sclerosis
Huiling XIONG ; Wenzu CHEN ; Zhiying WU ; Zhenhua ZHAO ; Ning WANG ; Minting LIN ; Shenxing MURONG
Chinese Journal of Neurology 2010;43(2):90-92
Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.
10.Investigation of survival motor neuron gene deletion in Chinese patients with sporadic amyotrophic lateral sclerosis
Zongquan SU ; Shirui GAN ; Zhiying WU ; Wanjin CHEN ; Yan CHEN ; Ning WANG ; Shenxing MURONG ; Chuanzhen Lü
Chinese Journal of Neurology 2009;42(4):245-247
Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Result Analysis
Print
Save
E-mail