Objective To study the expression of normal and variant ATP7B proteins, in order to further find the mechanism of Wilson disease. Methods Normal ATP7BcDNA/pcDNA3 was made and mutant variants Arg778Leu/pcDNA3, Gln914Ter/pcDNA3 and Thr935Met/pcDNA3 were constructed by using Quik-Change TM Site-directed Mutagenesis Kit in vitro. A good quality rabbit polyclonal antibody against the N-terminal functional domains of ATP7B was produced and purified, being named rabbit anti-human ATP7Bn33-629 polyclonal antibody. Normal and variant expression plasmids constructed above were transfected into Chinese hamster ovary (CHO) cells. After a 36-hour incubation at 37℃, the transfected CHO cells were collected. Expression of normal and variant ATP7B protein were detected and compared by Western blot analysis of cell lysates using ATP7Bn33-629 antibody. Results Expression of ATP7B normal protein in transfected CHO cells was the same as that of ATP7B variant proteins Arg778Leu and Thr935Met.Gln914Ter variant shortened ATP7B protein to 100 kd and increased the level of expression. Conclusion The mechanism under disorder of copper transport caused by the missense mutations should be not related to the level of expression. The increased level of expression caused by Gln914Ter might be associated with the shortened ATP7B protein that needs less time for translation.

[Objective] To observe the antitussive and antiasthmatic actions of Nervilia fordii (Hance) Schitr. (NF). [Methods] NIH mice were randomized into 8 groups: 3 NF water-extract groups and 3 NF ethanol-extract groups in high, moderate and low doses (19.2, 9.6 and 4.8 g?kg-1?d-1 respectively), positive control group (codeine phosphate 50 mg?kg-1?d-1 in the antitussive experiment and theocin 0.1g?kg-1?d-1 in the antiasthmatic experiment) and model group. Mice cough models induced by ultrasonic spray of ammonium hydroxide and guinea pigs asthma models induced by ultrasonic spray of histamine-acetylcholine mixture were adopted to observe the antitussive and antiasthmatic actions of NF. [Results] Water-extract and ethanol-extract of NF in three doses decreased the cough frequency in mice, and ethanol-extract of NF in three doses prolonged the cough latent period (P

Objective To study the clinical and genetic features of familial paroxysmal kinesigenic dyskinesias (PKD). Methods The clinical information of PKD patients from 3 Han families was analyzed and the pedigrees were further investigated. Results There were 25 PKD cases in 3 families, including 16 males and 9 females. The onset age ranged from 1 to 10 years. The attacks were provoked by voluntary movements and each attack lasted less than 30 seconds with no loss of consciousness. No neurological signs and abnormal examination were detected during the intermittent period. There were 10 to 50 attacks per day, but the frequency commonly decreased with the increase of age. The attacks can be controlled by carbamazepine. The disease was inherited in an autosomal dominant mode. Males were affected more severely than females. Conclusions The main inheritance mode of familial PKD is autosomal dominant. There may be clinic or genetic heterogeneity.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

OBJECTIVE To study the risk factors and protection measures for the occupational exposure to HBV,and reduce the occupational exposure risk of blood.METHODS A survey was carried out among 1352 medical staff.And then we carried on the analysis to 43 questions of it and used Logistic regression analytic method to find out the risk factors and protective measures.RESULTS Seventy one persons had occuptional exposure risk to HBV and 56 persons had needle puncture wound or sharp wound.The risk factors included needle puncture wound or sharp wound,blood contaminated skin and mucous membrane,and the long working life.While knowledge of infection control,protection consciousness,washing hands,using gloves,and wearing glasses were the protective factors.CONCLUSIONS It plays the vital role to reduce occupational exposure to HBV that the medical staff should reduce injury in work,vaccinate the HBV vaccine,use protection goods and raise the protection consciousness.

AIM: To study the protective effects of Xiaoyan Lidan Tablet(Herba Andrographis,Herba Rabdosiae serrae,Radix Sophorae Flavescentis,etc) on acute hepatic injury in rats. METHODS: Acute hepatic injury was induced by intraperitoneal(ip) injection of carbon tetrachloride and D-galactosamine,respectively.The levels of ALT,AST,ALP,TBA,total bilirubin(T-Bil),total protein (TP) and albumin(ALB) in serum were analyzed.The body weight,liver weight,spleen weight and thymus weight of each rat were measured.The hepatic glycogen content was analyzed individually.Liver tissue pathology was observed. RESULTS: Xiayan Lidan Tablet can decrease ALT,AST,ALP,TBA and T-Bil in serum,reduce necrosis in pathological observation. CONCLUSION: Xiaoyan Lidan Tablet gives the protective effects to acute hepatic injury induced by CCl_4 and D-Gal in rats.