Objective To investigate the effects of isoflurane and sevoflurane at the same dose on expression of Caspase-3 of primary somatosensory cortex (SI) and expression of micmmbule associated protein 1B (MAP1B)in cortical neuronsin neonatal SD rats.Methods Fifty-five neonatal SD rats at postnatal day 7 (eleven rats each litter,altogether 5 litters)were assigned randomly into control group(C group),isoflurane group (I group)and sevoflursne group(S group)in average.The rats in I group,S group or C group were exposed to 1.1% isoflurane or 1.8% sevoflurane (equivalent to 0.5MAC)or air 4h.The brain of neonatal rats were perfused and embedded by paraffin,Caspase-3 positive expression in the SI cortex of brain was detected by immunohistochemistry staining.Besides,the fresh cortex was dissected at O h in C group and at 2h,4h in I group and S group,microtubule associated protein 1 B expression was detected by West blot staining.Results Caspase-3 positive cells in the SI cortex were increased by 561.23%in I group(t=4.45,P<0.01)and 194.46% in S group(t=5.17,P<0.01)when compared with C group,and increased by 124.45% in I group(P<0.05)when compared with S group.The MAP1B protein was increased by 557.15%at 2h(t=16.54 P<0.01)and 475.21% at 4h(t=32.97,P<0.01)in I group while increased by 693.11%at 2h(t=9.45,P<0.001)and 268.15% at 4h(t=2.79,P=0.049) in S group when compared with C group.In S group,MAP1B protein at 4h reduced by 53.65%(P<0.01) when compared with that at 2h.Conclusion 0.5 MAC isoflurane can induce more apoptosis in the cortex in the neonatal rats'brain at postnatal day 7 than sevoflurane.They can both significantly promote the expression of MAP1B in the cortex to start the self-reparation.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.

Objective To investigate the effects of peptidoglycan (PGN) with different concentrations on Toll-like receptor 2 (TLR2),Toll-like receptor 4 (TLR4) expression in corneal epithelial cells of mice.Methods Corneal epithelial cells of c57 mice were cultured in vitro.Cells were divided into blank control group and 10 mg · L-1 group,30 mg · L-1 gruop and 80 mg · L-1 group (treated by different concentration of PGN for 12 hours).In the meantime,the cells in 30 mg · L-1 group were cultured for different times(named 12 hours group,24 hours group,36 hours group).Expressions of TLR2 and TLR4 mRNA and protein in different group were measured by RT-PCR and flow cytometry.Results Compared with control group (1.00 ± 0.14,1.00 ± 0.01),the expression of TLR2,LR4 mRNA in 10 mg · L-1 group (4.35 ± 0.46,3.53 ± 0.50),30 mg · L-1 group (8.06 ±0.72,5.31 ±0.34),80 mg · L-1 group (2.93 ±0.46,2.23 ±0.04) were increased,the differences were statistically significant (all P ＜ 0.05).Compared with control group,the expression of TLR2,TLR4 protein in different concentration group and 12 hour group were increased,the differences were statistically significant (all P ＜ 0.05).Conclusion PGN can up-regulate both mRNA and protein expression of TLR2 and TLR4 in corneal epithelial cells of mice,suggest that TLR2 and TLR4 in the corneal epithelial cell can recognize some exogenous pathogen and regulate the inflammatory reaction,which are closely related to the occurrence and development of infectious keratitis.

[Summary] Hypercalcemia in pregnancy is a rare condition which brings considerable risks to mother and fetus. The most common cause is primary hyperparathyroidism(PHPT). The untypical symptoms and biochemical tests results add obstacles in the diagnosis of PHPT during pregnancy. The management is difficult, due to restrictions in choices of treatments and lack of clinical guidelines. Severity evaluation which takes consideration of calcium homeostasis during pregnancy is crucial for appropriate management. Parathyroidectomy during the second trimester is recommended for those with high serum calcium levels.

Acute cellular rejection (ACR) is a common complication after lung transplantation, which is mainly caused by the immune response of T lymphocytes recognizing the major histocompatibility complex on the cellular surface of grafts. It is currently considered as the main pattern of acute rejection. ACR is not only a direct cause of death of recipients, but also a high-risk factor for chronic rejection after lung transplantation. Nevertheless, it is a challenging task to deliver the diagnosis and treatment of ACR following lung transplantation. In this article, new progresses on the risk factors, pathogenesis, diagnosis and treatment of ACR in lung transplant recipients were summarized, aiming to improve the diagnostic and treatment efficiency of ACR and prolong the survival of recipients.

Objective To study the clinical, pathological, imaging features of two cases of central core disease (CCD) with different inheritance and to explore the similarities and differences between autosomal recessive CCD (AR-CCD) and autosomal dominant CCD (AD-CCD). Methods Clinical manifestations, family history, muscle MRI and muscle biopsy were collected. Targeted next generation sequencing (NGS) and sanger sequencing were applied for genetic analysis. Co-segregation analysis was further conducted in one family. Results Their common clinical manifestations included childhood early-onset proximal limbs muscle weakness and dystrophy accompanied with facial involvement. The MRI revealed extensive muscular dystrophy and fatty filtration in the both thighs, but not in rectus femoris. Pathology of skeletal muscle showed typical central cores in type Ⅰ muscle fibers and eccentric cores only in AR-CCD. Targeted NGS identified 3 missense mutations in RYR1, including one novel mutation. Conclusion The present study has described clinical and pathological features of two typical CCD patients with different inheritance, which may be associated with the different mutations in RYR1 gene. Targeted NGS apparently improves the genetic diagnosis of CCD.

Objective To study the clinical, laboratorial, histopathological, imaging features of two cases of hypothyroid myopathy. Method Clinical manifestations, thyroid function, electromyography, muscle MRI, muscle biopsy and follow-up results were collected, and analyzed with the literature. Result These two patients were middle-age to old age and the onset of disease was insidious. Their common clinical manifestations included subacute progressive weakness in the proximal muscles,myalgia after sports and reduction in tendon reflex.The blood test showed an increase in serum concentration of CK and TSH, and a decrease in FT3 and FT4. The electromyography showed suspicious myogenic damage.Muscle histopathological findings were largely nonspecific,such as type I fiber predominance and type 2 atrophy. The MRI revealed extensive muscular dystrophy and fatty filtration in the posterior group of thighs. Treatment of replacement therapy with L-T4 relieved the myopathic symptoms quickly. Conclusion When a patient presents with a subacute progressive weakness in the proximal muscles, the hypothyroidism should be consideration. Muscle histopathological findings may be nonspecific. The muscle MRI have a value of differential diagnosis and lesion assessment.

Objective:To explore the clinical manifestations and imaging features of nocardia infection (NI) after lung transplantation and boost the diagnosis and treatment of NI.Methods:From January 2018 to December 2019, basic profiles, clinical manifestations, laboratory examinations, imaging features and treatment outcomes of 5 lung transplant recipients with a diagnosis of NF were retrospectively analyzed and summarized with the relevant literatures. There were 4 males and 1 female with a median age of 66(26-69) years. 3 patients were single-lung transplantation, 2 patients were bilateral-lung transplantation. The median time from an initial diagnosis of NI to lung transplant surgery was 6(5-19) months. Common symptoms included fever, cough with yellow phlegm and shortness of breath. Laboratory findings showed lymphopenia, significantly high C-reactive protein levels, a slight elevation of procalcitonin, hypoproteinemia and anemia. The major manifestations of high-resolution computed tomography (CT) included multiple nodules, consolidation, cavitation and pleural effusion.Results:Five strains of N. farcinica were identified from bloodstream infection ( n=2) and pulmonary infection ( n=3). After with a combined therapy of two sensitive agents, all patients improved and were discharged from hospital. During follow-ups, one patient died and the remainders were cured. Conclusions:Nocardia infection occurs in lung transplant recipients mostly within 1 year post-operation. There are non-specific symptoms and imaging features of multiple nodules and consolidation. Combination therapy of sensitive agents is indicated for lung transplant recipients with NI.