Objective To investigate the influence of parental compliance on the therapeutic effect of children with epilepsy.Methods Two hundred and sixty children with epilepsy and their parents admitted to the First People's Hospital of Wenling from December 2013 to June 2016 were enrolled,and the classical Morisky medication adherence questionnaire (MMAS-8) was applied to evaluate the compliance of parents for treatment of their children with epilepsy;after the patient taking drug for 3 days,fasting venous blood was collected in the morning,the concentration of the blood drug was tested and the influence of parent compliance on the blood drug concentration of the child with epilepsy was evaluated.Results In 260 patients,122 cases took karma form,and 138 cases took valproate orally.There were parents with good medication compliance in 130 cases (50％),medium medication compliance 80 cases (30.76％) and poor adherence to the doctor order in 50 cases (19.23％).In cases using medication irregularly,there were 26 cases sometimes without taking any drug (10.0％),17 patients' medication being interrupted (6.54％) and 10 cases having excessive medication (3.85％);no relationships were found between parental compliance and each of the following items,family role,occupation and age (all P ＞ 0.05);and the compliance was related to gender,indicating that women's good compliance level was higher than that of males';the education level was positively proportional to the compliance,and the compliance of parents with senior high school or above degree was higher than those with primary school and junior secondary school levels (83 cases vs.9 cases,38 cases,both P ＜ 0.01).Under situation of parents with poor compliance,their children had blood drug concentration higher or lower than proper range of drug level (high in 22 cases,low in 41 cases,higher than the result in good compliance 0 cases and 17 cases respectively),thus seriously affected the safety and efficacy of the treatment;the patients' frequency of irregular medication in parents' good compliance group was significantly lower than that in parents' poor compliance group [3.08％ (4/130) vs.72.0％ (36/50),P ＜ 0.05].Conclusion To improve the therapeutic effect of epileptic children,their parental good cooperation is necessary.

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics* ; Child ; Developmental Disabilities ; Female ; Humans ; Mutation ; Retrospective Studies ; Syndrome ; Transcription Factors/genetics*