Objective By organizing and implementing a laboratory proficiency validation plan for air change rate testing, this study aims to explore proficiency testing approaches in laboratory animal facilities, assess the current status of relevant laboratories regarding standard application and test capabilities, standardize air change rate testing methods, and ensure the accuracy and reliability of test results. Methods From September to November 2023, the National Institutes for Food and Drug Control (NIFDC) organized a laboratory proficiency validation plan for air change rate testing in laboratory animal facilities (Plan Number: NIFDC-PT-417). The proficiency testing was conducted on-site and consisted of two parts: a written test and practical operation. The written test was open-book. True/false questions focused on participants' understanding of specific clauses in relevant standards, while application-based questions assessed their ability to handle data processing in simulated testing scenarios. The practical operation was conducted according to the relevant criteria of the China National Accreditation Service for Conformity Assessment (CNAS). Two laboratory animal rooms were prepared as proficiency testing samples using a sample splitting approach. These rooms underwent uniformity and stability testing according to CNAS requirements and were approved. Participating laboratories were required to conduct three tests on each of the two laboratory animal rooms, complete the testing and calculation of air change rate within the specified timeframe, and submit their test result reports and original records. Results A total of 27 laboratories registered and participated in the proficiency testing. All participating laboratories submitted their results within the designated timeframe, and the outcomes of all tested laboratories were rated as satisfactory. Conclusion This proficiency validation program objectively and scientifically evaluates the air change rate testing capabilities of selected domestic laboratories, effectively promoting the overall improvement of testing capabilities in the industry. It provides technical support for regulatory authorities to standardize testing institutions and offers reliable references for the purchase of testing services. Through this activity, it was identified that some laboratories need to further enhance their calibration of instruments and the utilization of calibration results. Future efforts should focus on refining related standards to improve the accuracy and reliability of testing.

Approximately 60% of colorectal cancer (CRC) patients exhibit TP53 mutations, which are strongly associated with tumor progression, chemotherapy resistance, and an unfavorable prognosis. However, targeting p53 has historically been challenging, and currently, there are no approved p53-based therapeutics for clinical use worldwide. In this study, we discovered that ubiquitin carboxyl terminal hydrolase L3 (UCHL3) plays a crucial role in high-level glycolysis, enhanced stem-like properties, and 5-fluorouracil (5-FU) chemoresistance in TP53-mutant CRC by exerting its deubiquitinating enzyme activity to stabilize α-enolase (ENO1) protein. Notably, we identified a newly Food and Drug Administration (FDA)-approved drug, pacritinib, that potently suppresses UCHL3 expression by blocking the janus kinase 2 (JAK2)-signal transducer and activator of transcription 3 (STAT3) pathway in TP53-mutant CRC. Furthermore, Pacritinib was demonstrated to effectively inhibit glycolysis and improve the sensitivity to 5-FU chemotherapy in TP53-mutant CRC. Our findings suggest that targeting the JAK2-STAT3-UCHL3-ENO1 axis is a promising strategy to suppress glycolysis and enhance the efficacy of 5-FU chemotherapy in TP53-mutant CRC. Pacritinib shows potential for clinical application in the treatment of TP53-mutant CRC.

Objective To overcome the limitations of existing human respiratory syncytial virus(hRSV)animal models,such as semi-permissiveness and short duration of infection,this study established an IL2rg gene knockout(IL2rg-/-)rat model using TALEN gene editing technology.Methods The animal model was infected with hRSV intranasally.Clinical characteristics,body weight,and temperature changes were observed over the infection period(0～35 days).The total viral loads in respiratory organs,such as the nasal tissue,trachea,and lungs,were measured at various time points(4,11,20,and 35 days post-infection).Pathological analysis was conducted on target organs at the endpoint of observation(35 days post-infection).Changes in peripheral blood T,B,NK,and NKT cells and various cytokines were assessed at various time points(4,20,and 35 days post-infection).Results(1)IL2rg/-knockout rats sustained high viral loads in the nasal cavity upon intranasal inoculation with hRSV.The average peak titer rapidly reached 1 × 1010 copies/g in nasal tissue and 1 × 107 copies/g up to 5 weeks post-infection.(2)However,no significant pathological changes were noted in nasal,tracheal,or lung tissues.(3)An increase was observed in the content of peripheral blood B cells in hRSV-infected IL2rg--rats.(4)IL-6 and MCP-1 were increased in the early stage of infection and then decreased at the end of the observation period.Conclusions This study established a new IL2rg-/-rat model using TALEN technology and found that this model effectively supported high-level replication and long-term infection of hRSV,providing a good basis for antiviral drug screening and in vivo efficacy evaluation of anti-hRSV antibodies.

Objective:To establishment an assay for HIV-1 intact proviral DNA assay through droplet digital PCR (ddPCR).Methods:DNA was extracted by culturing 8E5 cells, a Tlymphocyte cell line containing a single copy of integrated HIV-1 provirus. Serial diluting DNA were prepared by amplified 1-fold, 5-fold, 25-fold, 625-fold, 3 125-fold, and 15 625-fold across the HIV-1 Ψ region, env region, and eukaryotic chromosome 10 RPP30 regions, and the linear relationship was calculated and the minimum detection concentration. DNA solution of 5 μl, 3.1 μl, 2.5 μl was added to the ddPCR mixture respectively, with each dilution undergoing two batches of detection, and each was repeated four times. The intra-batch variation coefficient was detected, while the inter-batch variation coefficient was detected by the same DNA amount and different DNA amounts to determine the stability; 8E5 cell was used to detect the intact proviral content in cells.Results:The linear fitting goodness of Ψ region, env region and RPP30 region are R2≥0.999, R2≥0.993, R2≥0.996 in 6 dilutions of DNA, respectively. At a 3 125-fold dilution, the lowest positive droplets were detected in the Ψ region, env region and RPP30 region were 3, 2 and 2, respectively, the detected concentrations were 2.37 copies/μl, 1.21 copies/μl and 1.58 copies/μl. The ddPCR repeatability experimental detecting DNA showed that the Ψ region of the intra-batch variation coefficients ranged from 0.66% to 3.43%, with the inter-batch variation coefficients of the same DNA at 3.19%, 4.3% and 3.45% respectively, and the inter-batch variation coefficients of the different DNA at only 4.35%. The env region of the intra-batch variation coefficients ranged from 0.7% to 3.20%, with the inter-batch variation coefficients of the same DNA at 3.18%, 4.52% and 3.4% respectively, and the inter-batch variation coefficients of the different DNA at only 4.02%. The RPP30 region of the intra-batch variation coefficients ranged from 0.91% to 2.91%, with the inter-batch variation coefficients of the same DNA at 3%, 4.55% and 3.37% respectively, and the inter-batch variation coefficients of the different DNA at only 3.98%. The proportion of 8E5 cells containing defective provirus and the proportion of intact provirus were calculated to be approximately 90% and 45%, respectively. Conclusions:Droplet digital PCR used to detect HIV-1 intact proviral DNA, showed strong stability and provided a technical means for HIV-1 infection reservoir detection.

Science and technological advancements drive human progress, with laboratory animals serving as essential resources for developments in life sciences and medicine. However, the waste generated by these animals presents new challenges for urban management. Issues such as classification, recycling, effective utilization, and biohazard elimination must be addressed, necessitating the development of regulations, standards, and norms to keep pace with advancements. The construction of quality management system is the foundation and framework for the management of inspection and testing organizations. It should have strong operability and inspectability, enabling continuous improvement of the management level and enhancing the stability of basic management. However, current quality management systems often lack clarity in managing laboratory animal waste, including undefined disposal processes for non-medical institutions, inaccurate waste classification, and inadequate disposal methods for different waste categories. This paper addresses these challenges by identifying necessary processes to be added or removed in the quality management system of National Institutes for Food and Drug Control, developing effective SOPs, proposing practical measures to strengthen supervision and management, and integrating 6S management principles into our quality management system. In conclusion, effective management of laboratory animal waste should be centered on improving the quality management system, emphasizing waste classification and management at the source, controlling biological hazards, minimizing environmental pollution and promoting conditions for sustainable development.

Objective To investigate the correlation between somatosensory evoked potentials(SEP)of upper limbs,and sensory and motor functions in stroke patients in different stages. Methods From June,2021 to October,2023,177 stroke patients in Shijiazhuang People's Hospital were diveded into acute stage group(within 14 days,n=25),early recovery group(14 days to one month,n=110)and middle to late recovery group(one to six months,n=42)according to the duration of the disease.General information of the patients was recorded;SEP examination was performed,and N20 lantency and amplitude were recorded.Monofilament touch and two-point discrimination sensation of the patient's hands were tested using the monofila-ment and two-point discrimination tools,respectively;and motor function was assessed with Fugl-Meyer Assess-ment-Upper Extremities(FMA-UE).The correlation between SEP,and the sensory and motor scores in each group was analyzed. Results There was no significant difference in the monofilament tactile and two-point discrimination scores among the three groups(P>0.05).SEP was not correlated with sensory and motor functions in the acute stage group(P>0.05);in the early recovery group,N20 latency was negatively correlated with monofilament tactile sensation(r=-0.267,P=0.005)and positively correlated with two-point discrimination sensation(r=0.220,P=0.021),and N20 amplitude was positively correlated with monofilament tactile sensation(r=0.328,P<0.001)and FMA-UE score(r=0.418,P<0.001),and negatively correlated with two-point discrimination(r=-0.405,P<0.001);in the middle to late recovery group,the N20 latency was negatively correlated with FMA-UE score(r=-0.313,P=0.044),and N20 amplitude was positively correlated with monofilament tactile sensation(r=0.598,P<0.001)and FMA-UE score(r=0.393,P=0.010),and negatively correlated with two-point discrimination(r=-0.591,P<0.001).Multiple linear regression analyses showed that the score of monofilament tactile sensa-tion was negatively correlated with N20 latency(β=-0.510,P=0.046),and the FMA-UE score was positively correlated with N20 amplitude(β=0.313,P=0.026)in the middle to late recovery group;in the early recovery group,the two-point discriminative sensation score was negatively correlated with N20 amplitude(β=-0.270,P=0.039). Conclusion The correlation between SEP and sensory and motor functions becomes more significant with the prolonga-tion of disease.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Postoperative pain seriously affects the recovery process of patients, resulting in prolonged hospital stay and increased care costs. Appropriate application of patient-controlled analgesia devices can effectively relieve perioperative acute pain. In 1994 patient-controlled analgesia began to be used in Peking Union Medical College Hospital, and the Acute Pain Service Working Group was established in 2004. With the cooperation of anesthesiologists and specialist nurses, the group jointly has implemented the whole process and standardized management based on patient-controlled analgesia, and constantly improved and innovated working methods, laying a solid foundation for the development of postoperative pain management. This paper systematically reviews and summarizes the work from the aspects of clinical focus, nursing management experience, promotion and dissemination of pain treatment concepts, and development of acute pain service model under the new situation, with the hope of providing valuable reference for comprehensively strengthening pain management in the process of diagnosis and treatment, and enhancing patients' satisfaction with perioperative analgesia services.

To explore the general clinical features and treatment outcomes of patients with AIDS-related diffuse large B-cell lymphoma (AIDS-DLBCL) and provide a theoretical basis for diagnosis and treatment, survival prognosis, prevention and management of AIDS-DLBCL patients. AIDS-DLBCL patients who received combined antiretroviral therapy (cART) at Changsha First Hospital from January 2017 to January 2020 were selected in this study. The survival curves were plotted using the Kaplan-Meier method, and the Cox proportional hazards regression model was used to analyze the association between AIDS-DLBCL specific variables and progression-free survival and overall survival. Correlation analysis was conducted based on the clinical features of the patients. A total of 50 AIDS-DLBCL patients were included. Their median age ( Q 1, Q 3) was 52 (44, 59) years, of whom 46 (92%) were male. About 20 (40%) patients received treatment with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP), while 23 patients (46%) received treatment with rituximab combined with cyclophosphamide, doxorubicin, vincristine, and prednisone (RCHOP). Survival curve analysis showed that the 2-year progression-free survival rate and overall survival rate of AIDS-DLBCL patients were 56.9% and 61.6%, respectively. Patients with RCHOP protocol combined with EBV-DNA≥1 000 copies/ml had higher progression-free survival rate (χ 2=3.844, P=0.043) and overall survival rate (χ 2=4.662, P=0.031) than those with CHOP protocol combined with EBV-DNA≥1 000 copies/ml. A multivariate analysis showed that male ( HR=2.70, 95% CI:1.10-6.80), EB viral load≥1 000 copies/ml ( HR=1.75, 95% CI:1.12-2.84), HIV-RNA≥200 copies/ml ( HR=4.64, 95% CI: 1.73-12.15), ECOG PS score of 2 to 4 points ( HR=3.54, 95% CI:1.62-7.33), and international prognostic index (IPI) score of 3 to 5 points ( HR=5.21, 95% CI:1.39-20.14) were at a higher risk of disease progression. Patients with EB viral load≥1 000 copies/ml ( HR=0.07, 95% CI:0.05-0.93) on the RCHOP regimen had a small risk of disease progression. Males ( HR=2.87, 95% CI:1.65-9.17), EB viral load≥1 000 copies/ml ( HR=1.61, 95% CI:4.02-9.36), HIV-RNA≥200 copies/ml ( HR=1.19, 95% CI:1.58-2.74), ECOG PS score of 2 to 4 ( HR=6.42, 95% CI:2.55-14.33), IPI score of 3 to 5 points ( HR=2.78, 95% CI:1.41-12.96) had a high risk of mortality. Patients with EB viral load≥1 000 copies/ml ( HR=0.24, 95% CI:0.64-0.90) on the RCHOP regimen had a low risk of mortality. In summary, males, ECOG physical status score of 2 to 4 points, IPI score of 3 to 5 points, EB viral load≥1 000 copies/ml and HIV viral load≥200 copies/ml are risk factors affecting progression-free survival and overall survival of AIDS-DLBCL patients. RCHOP regimen combined with EB viral load≥1 000 copies/ml is a protective factor affecting progression-free survival and overall survival in AIDS-DLBCL patients.

Chronic kidney disease(CKD)is a common chronic disease.There is homology between retina and kidneys.Diabetic retinopathy and retinal neurovascular injury both reveal common pathophysiological features of ocular retina and kidney.Optical coherence tomography angiography(OCTA)detects chorioretinal microcirculation with near-histological resolution.Changes in microvascular structure and function can promote the development of hypertension,diabetes,CKD and related cardiovascular disease(CVD).The examination of fundus nerve microvessels by OCTA in patients with CKD is helpful to the identification of high-risk groups,and provides a new perspective for the assessment of disease progression and CVD risk prediction of patients with CKD.The combination of the deep learning will further expand this aspect of research and become the forefront of future development.