Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Background: The genetic basis for hyperglycaemia in pregnancy remain unclear. This study aimed to uncover the genetic determinants of gestational diabetes mellitus (GDM) and investigate their applications. Methods: We performed a meta-analysis of genome-wide association studies (GWAS) for GDM in Chinese women (464 cases and 1,217 controls), followed by de novo replications in an independent Chinese cohort (564 cases and 572 controls) and in silico replication in European (12,332 cases and 131,109 controls) and multi-ethnic populations (5,485 cases and 347,856 controls). A polygenic risk score (PRS) was derived based on the identified variants. Results: Using the genome-wide scan and candidate gene approaches, we identified four susceptibility loci for GDM. These included three previously reported loci for GDM and type 2 diabetes mellitus (T2DM) at MTNR1B (rs7945617, odds ratio [OR], 1.64; 95% confidence interval [CI],1.38 to 1.96]), CDKAL1 (rs7754840, OR, 1.33; 95% CI, 1.13 to 1.58), and INS-IGF2-KCNQ1 (rs2237897, OR, 1.48; 95% CI, 1.23 to 1.79), as well as a novel genome-wide significant locus near TBR1-SLC4A10 (rs117781972, OR, 2.05; 95% CI, 1.61 to 2.62; Pmeta=7.6×10-9), which has not been previously reported in GWAS for T2DM or glycaemic traits. Moreover, we found that women with a high PRS (top quintile) had over threefold (95% CI, 2.30 to 4.09; Pmeta=3.1×10-14) and 71% (95% CI, 1.08 to 2.71; P=0.0220) higher risk for GDM and abnormal glucose tolerance post-pregnancy, respectively, compared to other individuals. Conclusion Our results indicate that the genetic architecture of glucose metabolism exhibits both similarities and differences between the pregnant and non-pregnant states. Integrating genetic information can facilitate identification of pregnant women at a higher risk of developing GDM or later diabetes.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the synergistic effect and its mechanism of ginsenoside-Rg5 in combination with imatinib in inhibiting proliferation of chronic myeloid leukemia K562 cells. METHODS: K562 cells were treated with ginsenoside-Rg5 and imatinib. Cell survival was detected by CCK-8 assay, and IC₅₀ were calculated separately for each drug. Based on the value of IC₅₀ of ginsenoside-Rg5 and imatinib, an appropriate concentration gradient was selected for the combination. The synergistic effect of the two drug was analyzed using the online software synergy finder. The effects of single or combination therapy on apoptosis rate and the cell cycle distribution of K562 cells were analyzed by flow cytometry. Western blot was used to detect the expression of PI3K/AKT/mTOR signaling pathway related proteins and apoptosis related proteins in K562 cells after single or combination therapy. RESULTS: Ginsenoside-Rg5 and imatinib were able to inhibit the proliferative activity of K562 cells in a dosedependent manner(r =-0.991， r =-0.942). The synergy score ZIP >10 was measured by Synergy Finder online software, indicating that ginsenoside-Rg5 and imatinib act synergistically on K562 cells. The apoptotic rates of K562 cells after single treatments with ginsenoside-Rg5 and imatinib were 11.96% and 8.13%, respectively, while the rate increased to 21.35% with the combination of two drugs, the apoptosis rate in the combination group was higher than that in the single-drug group ( P <0.05). The proportion of K562 cells in the G₀/G₁ phase was significantly increased with the combined treatment of two drugs( P <0.05). The protein expression levels of p-PI3K, p-AKT, p-mTOR in K562 cells treated with the combination were significantly decreased, with noticeable downregulation of BCL-2 and upregulation of BAX, leading to a decreased Bcl-2/BAX ratio, while no significant changes were observed in the non-phosphorylated forms of PI3K, AKT, and mTOR proteins. CONCLUSION The combination of ginsenoside-Rg5 and imatinib can inhibit the proliferation of CML cells and induce apoptosis, and the mechanism may act through PI3K/AKT/mTOR signaling pathways.
Humans ; Ginsenosides/pharmacology* ; Imatinib Mesylate ; K562 Cells ; TOR Serine-Threonine Kinases/metabolism* ; Proto-Oncogene Proteins c-akt/metabolism* ; Signal Transduction/drug effects* ; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/metabolism* ; Drug Synergism ; Apoptosis/drug effects* ; Phosphatidylinositol 3-Kinases/metabolism* ; Cell Proliferation/drug effects*

OBJECTIVE: To explore the clinical characteristics and prognostic factors of patients with extranasal NK/T-cell lymphoma (NKTCL). METHODS: The clinical data of 138 patients with NKTCL diagnosed in 10 medical centers of Huaihai Lymphoma Working Group from June 2015 to April 2021 were collected and analyzed retrospectively. The differences in clinicopathological characteristics of patients with different involvement and efficacy of pegaspargase regimen were compared, as well as perform survival analysis. RESULTS: A total of 138 extranasal NKTCL patients were included, with a median age of 46 years, and the ratio of males to females was approximately 2∶1. There were 39 patients with gastrointestinal involvement, 32 patients with oropharyngeal involvement, 17 patients with skin involvement, 11 patients with lymph node involvement, 11 patients with orbital involvement, and 28 patients with other parts involvement. Patients with skin involvement had a higher proportion of advanced disease and a lower proportion of CD56 positive rate compared to those with oropharyngeal involvement. Among the patients with gastrointestinal involvement, the survival rate of patients who received pegaspargase regimen was significantly higher than those who were treated without pegaspargase (P < 0.01). Multivariate analysis showed that serum creatinine was an independent prognostic factor for patients with skin involvement ( HR =1.027, 95%CI : 1.001-1.054, P =0.040), ECOG PS and EBV DNA were independent prognostic factors for patients with gastrointestinal involvement ( HR =2.635, 95%CI : 1.096-6.338, P =0.030; HR =4.772, 95% CI : 1.092-20.854, P =0.038), and ECOG PS and CA stage were independent prognostic factors for patients with oropharyngeal involvement ( HR =13.875, 95%CI : 2.517-76.496, P =0.002; HR =20.261, 95%CI : 2.466-166.470, P =0.005). CONCLUSION The clinicopathological characteristics of extranasal NKTCL patients with different sites of involvement are vary, and effective individualized treatment need to be further explored.
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Asparaginase/therapeutic use* ; Lymphoma, Extranodal NK-T-Cell/pathology* ; Prognosis ; Retrospective Studies ; Survival Rate ; Polyethylene Glycols

OBJECTIVE: To analyze the effects of the Focused Solution Model Nursing intervention on quality of life, negative emotions of the patients with prostate cancer. Methods： A total of 82 prostate cancer patients who were diagnosed and treated at the General Hospital of Eastern Theater Command between September 2022 and September 2024 were included and randomly divided into study group and control group by the method of random number table, with 41 patients in each group. The patients in the study group were treated with Focused Solution Model Nursing intervention. And the routine care was used in the control group The quality of life and negative emotions were compared between the two groups by using the scales of World Health Organization Quality of Life-Brief (WHOQOL-BREF), HAMA and HAMD. RESULTS: Compared to the control group, the patients in the study group exhibited significantly higher scores in the physiological, psychological, environmental, and social relationship domains of the WHOQOL-BREF scale (P<0.05). The scores of HAMA and HAMD in study group were lower than those of the control group (P<0.05). Additionally, all subscales of the Social Impact Scale including social exclusion, internalized shame, social isolation and economic discrimination were significantly lower than those of the study group (P<0.05). CONCLUSION Focused Solution Model Nursing intervention can effectively improve the quality of life and negative emotions of the prostate cancer patients in the clinical treatment.
Humans ; Male ; Quality of Life ; Prostatic Neoplasms/nursing* ; Emotions ; Surveys and Questionnaires ; Middle Aged

OBJECTIVE: To explore the efficacy of predictive nursing on the recovery of patients after endoscopic surgery for prostate under the concept of enhanced recovery after surgery（ERAS）. METHODS A total of 82 patients with benign prostatic hyperplasia who underwent surgery from February 2022 to February 2023 were divided into control group (n=41) with traditional care and the observation group (n=41) with predictive care based on the difference in nursing methods. And the clinical data of the two groups were compared. Results： The observation group showed lower incidence rates than the control group for all individual complications (urinary tract infection ［2.44% vs 4.88%］, hemorrhage ［2.44% vs 7.32%］, bladder spasm ［0% vs 4.88%］, and hypostatic pneumonia ［0% vs 2.44%］), though none reached statistical significance (P>0.05). However, the total complication rate was significantly lower in the observation group (4.88% vs 19.51%, P < 0.05). Notably，the observation group demonstrated significantly lower IPSS scores (5.49±1.53 vs 10.35±1.77, P<0.05) and shorter hospital stays (［5.26±0.38］ d vs ［9.95±0.84］ d, P<0.05). Additionally, nursing satisfaction was markedly higher in the observation group (92.68% vs 78.95%, P<0.05).Conclusion： The application of ERAS -guided anticipatory nursing in postoperative rehabilitation for patients with benign prostatic hyperplasia can significantly improve quality of life, reduce complication rates, shorten hospital stays, and enhance patient satisfaction.
Humans ; Male ; Prostatic Hyperplasia/nursing* ; Endoscopy ; Postoperative Complications/prevention & control* ; Aged ; Enhanced Recovery After Surgery ; Middle Aged ; Prostate/surgery*

OBJECTIVE: To investigate the influence of different scanning conditions on the image quality of medical electron accelerator cone-beam computed tomography (CBCT) and provide a reference for the selection of scanning conditions for different body parts. Methods Set different scanning conditions, the Catphan 503 phantom was scanned using CBCT parameters to analyze the influence of spatial resolution, noise, uniformity, spatial geometric accuracy, and low-contrast resolution on the image quality of CBCT. RESULTS: For the head, chest, and abdomen, with the increase in scanning parameter values, the noise value decreased by 47.4%, 26.1%, and 51.3% respectively, and the uniformity values decreased by 30.2%, 26.6%, and 47.9% respectively. The low-contrast resolution values decreased by 50.6%, 34.2%, and 12.0%. The influence of different scanning conditions on spatial geometric accuracy and spatial resolution is not significant. CONCLUSION Different scanning parameters have a certain influence on the image quality of medical electron accelerator CBCT. Lower scanning parameters can be selected based on individual patients to reduce the additional radiation dose, providing a reference for the safe application of CBCT image guidance in radiotherapy.
Cone-Beam Computed Tomography/instrumentation* ; Phantoms, Imaging ; Particle Accelerators