1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Mechanism of Electroacupuncture Alleviating Inflammatory Pain in Rats by Regulating ErbB Subtypes in the Spinal Dorsal Horn
Yuxin WU ; Shuxin TIAN ; Zhengyi LYU ; Dingru JI ; Xingzhen LI ; Yue DONG ; Binyu ZHAO ; Yi LIANG ; Jianqiao FANG
Journal of Traditional Chinese Medicine 2026;67(1):69-78
ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor (ErbB), namely ErbB1, ErbB2, ErbB3, and ErbB4, in the spinal dorsal horn of inflammatory pain model rats, and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)". MethodsThe study was divided into five parts. In experiment 1, 14 Sprague Dawley (SD) rats were randomly divided into control and inflammatory pain group (7 rats each group) to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2, 30 rats were randomly divided into control group 1, inflammatory pain group 1, and low-, medium-, and high-concentration TX1-85-1 groups, with 6 rats in each group, to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3, 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group, with 6 rats in each group, to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4, 44 rats were randomly divided into control group 2, inflammatory pain group 2, electroacupuncture group, and sham electroacupuncture group, with 11 rats in each group, to observe the effect of electroacupuncture. In experiment 5, 40 rats were randomly divided into control group 3, inflammatory pain group 3, electroacupuncture group 1, and electroacupuncture + NRG1 group, with 10 rats in each group, to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-, medium-, and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA (shRNA) into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli (ST 36)" and "Kunlun (BL 60)" from day 1 to day 7 after modeling, with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 (NRG1) after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1, 3, 5, and 7 after modeling to evaluate behavior, and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group, rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats, and increased expression of phosphorylated ErbB3 (p-ErbB3) protein in the spinal dorsal horn on days 1, 3, 5, and 7 after modeling (P<0.01). On day 5 and day 7 after modeling, compared with the inflammatory pain group 1, the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 1, 3, 5, and 7 after modeling, compared with the control virus group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased (P<0.05). On day 5 and day 7 after modeling, compared with the inflammatory pain group 2 and the sham electroacupuncture group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 5 and day 7 after modeling, compared with the electroacupuncture + NRG1 group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased (P<0.05). ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain, and electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.
3.Epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome in Zhejiang Province
LÜ ; Jing ; XU Xinying ; QIAO Yingyi ; SHI Xinglong ; YUE Fang ; LIU Ying ; CHENG Chuanlong ; ZHANG Yuqi ; SUN Jimin ; LI Xiujun
Journal of Preventive Medicine 2026;38(1):10-14
Objective:
To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control.
Methods:
Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence.
Results:
A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk.
Conclusions
SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.
4.Proteomic Analysis of Danlou Tablet in Improving Platelet Function for Treating Coronary Heart Disease with Phlegm-stasis Intermingling Syndrome in Minipigs
Ziyan WANG ; Ying LI ; Aoao WANG ; Hongxu MENG ; Yue SHI ; Yanlei MA ; Guoyuan ZHANG ; Lei LI ; Jianxun LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(5):41-53
ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease (CHD) with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group (6 pigs) and a high-fat diet group (24 pigs). After 2 weeks of high-fat diet feeding, the high-fat diet group was randomly subdivided into a model group, an atorvastatin group (1 mg·kg-1), and Danlou tablet groups (0.6 g·kg-1 and 0.3 g·kg-1). All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet, underwent only coronary angiography, and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later, they underwent a coronary angiography injury procedure. After the procedure, drugs were mixed into the feed every morning for 8 consecutive weeks, with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins, and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group, the model group showed a significant increase in total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) of minipigs' serum (P<0.01), a significant shortening in prothrombin time of (PT) (P<0.01), a coagulation function index, and an increase in whole blood viscosity (P<0.01) and platelet aggregation rate (P<0.01). Moreover, the platelet morphology was altered, and the contents of endothelin-1 (ET-1) and nitric oxide (NO) were significantly increased (P<0.01). Hemodynamic parameters were obviously abnormal, including significantly decreased systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP), left ventricular systolic pressure (LVSP), and left ventricular maximal positive dp/dt (LV+dp/dtmax) (P<0.01). Left ventricular maximal negative dp/dt (LV-dp/dtmax) was significantly increased (P<0.01). Besides, there were myocardial cell hypertrophy, obvious edematous degeneration, massive interstitial inflammatory cell infiltration, high degree of fibrosis, and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg-1 and 0.3 g·kg-1 (P<0.05, P<0.01), compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg-1 (P<0.05). The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg-1 (P<0.05). In groups with all doses of Danlou tablet, maximum aggregation rate (MAR) and average aggregation rate (AAR) were significantly decreased (P<0.05, P<0.01), and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg-1, NO level in the serum was reduced (P<0.05). In groups with all doses of Danlou tablet, DBP and MAP were significantly increased (P<0.05). In the Danlou tablet group with 0.6 g·kg-1, LVSP and LV+dp/dtmax were significantly increased (P<0.05, P<0.01), and LV-dp/dtmax was significantly decreased (P<0.05). In groups with all doses of Danlou tablet, edematous degeneration in myocardial tissue was milder, and coronary artery lesion degree was significantly alleviated. Compared with the normal control group, there were 94 differentially expressed proteins in the model group, including 81 up-regulated and 13 down-regulated proteins. Compared with the model group, the Danlou tablet group with 0.6 g·kg-1 showed 174 differentially expressed proteins, including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation, aggregation, and adhesion effects through biological pathways such as regulation of actin cytoskeleton, platelet activation pathway, Fcγ receptor-mediated phagocytosis, as well as proteins such as growth factor receptor-bound protein 2 (GRB2), Ras-related C3 botulinum toxin substrate 2 (RAC2), RAC1, and heat shock protein 90 alpha family class A member 1 (HSP90AA1). ConclusionDanlou tablet can effectively reduce platelet activation and aggregation, exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway, as well as proteins like GRB2, RAC2, RAC1, and HSP90AA1, thereby exerting a pharmacological effect in anti-platelet activation, aggregation, and adhesion.
5.Relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschoolers
LI Yameng, ZHU Xiaotong, SHAO Tianzeng, YUE Fengshan, REN Yiqi, REN Yuanchun
Chinese Journal of School Health 2026;47(1):104-108
Objective:
To analyze the relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschool children in a Beijing kindergarten, so as to provide a reference for promoting the development of motor competence.
Methods:
From September 2018 to March 2021, preschoolers aged 4-5 years were selected using convenience sampling method from an urban kindergarten in Beijing. The Test of Gross Motor Development-Third Version(TGMD-3) was used to assess basic preschoolers s gross motor skills ( n =152). The Pictorial Scale of Perceived Movement Skill Competence(PMSC) was used to evaluate perceptual motor skills ( n =151). Accelerometers (Actigraph GT3X) were used to record physical activity levels ( n =52). Data were analyzed using one way analysis of variance (ANOVA) and Pearson correlation coefficients.
Results:
The mean scores for gross motor skills and perceptual motor abilities were (38.76±13.48) and (35.49±6.50), respectively. The moderate to vigorous physical activity(MVPA) level was(52.60±27.44) minutes per day. No statistically significant correlations were found between gross motor skills, perceptual motor abilities MVPA among boys, girls or the overall group ( r =-0.20 to 0.25, all P >0.05). However, Boys locomotor skills, overall children s locomotor skills, and boys gross motor skills were all positively correlated with MVPA( r =0.34-0.45, all P <0.05).
Conclusion
There is a correlation between locomotor skills and physical activity levels in 4 to 5-year-old children.
6.Imaging characteristics and surgical methods of pulmonary nodules located in external lung 1/3 group versus internal lung 2/3 group
Dehao LIU ; Liangzhong LIAO ; Puchen LI ; Yue LIU ; Lichun CHEN
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):180-184
Objective To compare the imaging characteristics and surgical methods of pulmonary nodules in the external 1/3 group and internal 2/3 group. Methods A retrospective analysis of clinical data from patients who underwent thoracoscopic preoperative CT-guided lung nodule localization at the Department of Radiology, the First Affiliated Hospital of Xiamen University from September 2020 to April 2022 was conducted. Results A total of 215 patients were enrolled (247 pulmonary nodules), including 70 males and 145 females, with a median age of 48 years. Based on the location of the nodules under CT guidance, those located in the external 1/3 area of the lung were classified into an external 1/3 group, while those located in the middle 1/3 and inner 1/3 areas were classified into an internal 2/3 group. There was no statistical difference between the two groups in terms of general clinical data, nature of pulmonary nodules, distribution of pulmonary nodules in lobes, localization time, or localization complications (P>0.05). However, there were statistical differences in the distance of pulmonary nodules from the pleura [0.6 (0.0-1.9) cm vs. 1.8 (0.0-4.5) cm, P<0.001], size of pulmonary nodules [0.7 (0.2-1.8) cm vs. 1.0 (0.2-2.0) cm, P<0.001], and surgical methods (P=0.002). In the external 1/3 group, 92.1% of nodules underwent thoracoscopic wedge resection, while fewer patients underwent other procedures; in the internal 2/3 group, 77.1% of nodules underwent thoracoscopic wedge resection, and 19.3% underwent segmentectomy. Conclusion The diameter of pulmonary nodules, the distance of pulmonary nodules from the pleura, and surgical methods differ between the external 1/3 group and internal 2/3 group. Thoracic surgeons can develop more precise surgical plans based on the location and size of pulmonary nodules.
7.Application of Aromatic Inhalation Therapy in Preventing Respiratory Infectious Diseases Based on the Theory of "Aromatics Acting on the Spleen"
Xinxin WU ; Yue ZHANG ; Xiaolei LI ; Haoyue LI ; Fang ZHANG ; Nanjiang YU ; ZHAOJING
Journal of Traditional Chinese Medicine 2025;66(4):432-436
Aromatic inhalation therapy is a key traditional Chinese medicine (TCM) approach for preventing respiratory infectious diseases. Its foundational theory, "aromatics acting on the spleen", is deeply rooted in TCM principles and supported by modern medical research. The theory posits that the aromatic properties of medicinals primarily act on the spleen, and the aromatic inhalation therapy achieved its protective effects by modulation of the spleen and spleen channel to enhance the regulation of wei qi, striae and interstices. In TCM, the spleen is considered the mother of the lungs, with the function of nurturing lung; it is also seen as the source of wei qi, responsible for external defense; and the root of healthy qi, forming the foundation of acquired (postnatal) constitution. Thus, preventive strategies for respiratory infectious diseases focus on strengthening the spleen. From a modern medical perspective, the spleen's role in regulating lung immune responses, the shared immune functions of the respiratory and gastrointestinal mucosa, and the spleen's overall immune modulation provide scientific evidence for using aromatic inhalation therapy to prevent respiratory infections. Additionally, aromatic inhalation therapy offers several advantages, including direct action, rapid onset, minimal side effects, controllable risks, convenience, and ease of dissemination, making it a practical and effective preventive measure for respiratory infectious diseases.
8.The mechanism of Prim-O-glucosylcimifugin in improving cholesterol metabolism in osteoarthritis chondrocytes via lncRNA NEAT1/miR-128-3p
Yanming LIN ; Haishui TU ; Shujie LAN ; Chao LI ; Shiyu LU ; Yue CHEN ; Changlong FU
Journal of Beijing University of Traditional Chinese Medicine 2025;48(1):55-67
Objective:
To investigate the mechanism of action of Prim-O-glucosylcimifugin (POG) to improve cholesterol metabolism in osteoarthritic (OA) chondrocytes based on the long noncoding RNA nuclear-enriched transcript 1 (lncRNA NEAT1)/microRNA-128-3p (miR-128-3p) pathway.
Methods:
For in vivo experiments, 60 mice were divided into the normal, sham operation, model, and POG groups using the random number table method, with 15 mice per group. The osteoarthritis mouse model was constructed using the modified Hulth method in the model and POG groups. Mice in the POG group were administered 30 mg/(kg·d)POG by gavage. The other groups were administered an equal amount of normal saline for 8 weeks. The cartilage tissue structure of mice in each group was observed using hematoxylin and eosin staining. Real-time PCR was used to detect changes in the lncRNA NEAT1 and miR-128-3p mRNA expression levels in the cartilage tissues of mice. Western blotting was used to detect the protein expressions of ATP-binding cassette transporter A1 (ABCA1), liver X receptor β (LXRβ), matrix metalloprotein-3 (MMP-3), and B-lymphoblastoma-2-associated X protein (Bax) in articular cartilage of mice. An enzyme-linked immunosorbent assay was used to measure the tumor necrosis factor-α (TNF-α) content in the synovial fluid of mice. A biochemical microplate assay was used to measure the total cholesterol level in the synovial fluid of mice. The in vitro experiments were divided into the negative control, interleukin-1β(IL-1β), IL-1β+ POG, IL-1β+ oe-lncRNA NEAT1, IL-1β+ oe-lncRNA NEAT1 + POG, IL-1β + miR-128-3p inhibition, and IL-1β+ miR-128-3p inhibition+ POG groups. An OA model was established by inducing chondrocytes with IL-1β for 24 h, and 90 mg/L of POG and miR-128-3p inhibitor(50 nmol/L) were administered for 48 h as an intervention. lncRNA NEAT1 expression in chondrocytes was detected using fluorescence in situ hybridization. A dual luciferase assay was used to detect the targeting relationship between lncRNA NEAT1 and miR-128-3p. Lentiviral plasmids overexpressing lncRNA NEAT1 were used to transfect mouse chondrocytes. Real-time PCR was used to detect the effect of lncRNA NEAT1 overexpression on the mRNA level of miR-128-3p in chondrocytes. Western blotting was used to detect ABCA1, LXRβ, MMP-3, and Bax protein expression in chondrocytes after lncRNA NEAT1 overexpression and miR-128-3p inhibition.
Results:
POG significantly reduced OA cartilage tissue damage. Compared with the model group, the lncRNA NEAT1 mRNA level decreased, whereas the miR-128-3p mRNA level increased in the cartilage tissue of the POG group (P<0.05). Compared with the model group, ABCA1 and LXRβ protein expression increased in the POG group, whereas MMP-3 and Bax protein expression decreased (P<0.05). The TNF-α levels decreased in the POG group compared to the model group (P<0.05). Compared with the model group, the total cholesterol level in the synovial fluid of the joint of mice in the POG group decreased (P<0.05). The mean fluorescence intensity of lncRNA NEAT1 in the IL-1β+ POG group decreased compared with the IL-1β group (P<0.05). The relative luciferase activity in the miR-128-3p mimics group bound to the lncRNA NEAT1-WT plasmid decreased compared with the miR-128-3p negative control group (P<0.05). The lncRNA NEAT1 mRNA levels decreased, whereas the miR-128-3p mRNA levels increased in the IL-1β+ oe-lncRNA NEAT1 + POG group compared with the IL-1β+ oe-lncRNA NEAT1 group (P<0.05). Compared with the IL-1β+ POG group, ABCA1 and LXRβ protein expression decreased, whereas MMP-3 and Bax protein expression increased (P<0.05).
Conclusion
POG mediates lncRNA NEAT1/miR-128-3p to improve cholesterol metabolism in OA chondrocytes.
9.Enzyme-directed Immobilization Strategies for Biosensor Applications
Xing-Bao WANG ; Yao-Hong MA ; Yun-Long XUE ; Xiao-Zhen HUANG ; Yue SHAO ; Yi YU ; Bing-Lian WANG ; Qing-Ai LIU ; Li-He ZHANG ; Wei-Li GONG
Progress in Biochemistry and Biophysics 2025;52(2):374-394
Immobilized enzyme-based enzyme electrode biosensors, characterized by high sensitivity and efficiency, strong specificity, and compact size, demonstrate broad application prospects in life science research, disease diagnosis and monitoring, etc. Immobilization of enzyme is a critical step in determining the performance (stability, sensitivity, and reproducibility) of the biosensors. Random immobilization (physical adsorption, covalent cross-linking, etc.) can easily bring about problems, such as decreased enzyme activity and relatively unstable immobilization. Whereas, directional immobilization utilizing amino acid residue mutation, affinity peptide fusion, or nucleotide-specific binding to restrict the orientation of the enzymes provides new possibilities to solve the problems caused by random immobilization. In this paper, the principles, advantages and disadvantages and the application progress of enzyme electrode biosensors of different directional immobilization strategies for enzyme molecular sensing elements by specific amino acids (lysine, histidine, cysteine, unnatural amino acid) with functional groups introduced based on site-specific mutation, affinity peptides (gold binding peptides, carbon binding peptides, carbohydrate binding domains) fused through genetic engineering, and specific binding between nucleotides and target enzymes (proteins) were reviewed, and the application fields, advantages and limitations of various immobilized enzyme interface characterization techniques were discussed, hoping to provide theoretical and technical guidance for the creation of high-performance enzyme sensing elements and the manufacture of enzyme electrode sensors.
10.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.


Result Analysis
Print
Save
E-mail