ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Various proteins,signaling pathways,and inflammatory mediators are involved in the pathophysiological process of osteoarthritis.The development of small molecule drugs targeting these proteins,signaling pathways,and inflammatory mediators can effectively delay the progression of osteoarthritis and ameliorate its clinical manifestations. OBJECTIVE:To review the research progress of small molecule drugs in the treatment of osteoarthritis based on the pathogenesis of osteoarthritis. METHODS:PubMed,CNKI,and WanFang databases were searched with English search terms"osteoarthritis,arthritis,osteoarthrosis,degenerative,arthritides,deformans,small molecule drugs,small molecule inhibitors,small molecule agents"and Chinese search terms"osteoarthritis,small molecule drugs,small molecule inhibitors."A total of 68 articles were included for review according to the inclusion and exclusion criteria. RESULTS AND CONCLUSION:(1)Currently,studies concerning the pathogenesis of osteoarthritis remain unclear.The occurrence and development of osteoarthritis are strongly associated with proteins,cytokines,and signal transduction pathways,so its therapeutic mechanism is relatively complex.Currently,targeting proteins,cytokines,and signal transduction pathways related to osteoarthritis with small molecule drugs has become a major research focus.(2)Small molecule drugs frequently possess visible intracellular or extracellular targets and efficacy,containing enhancing cartilage repair,resisting joint degradation,attenuating inflammation,and relieving pain.Other anti-osteoarthritis small molecule drugs have shown promise in promoting stem cell chondrogenic differentiation and cartilage matrix reconstruction.(3)At present,small molecule drugs targeting the pathophysiological process of osteoarthritis to delay the progression of osteoarthritis are still in the experimental stage,but most of these small molecule drugs have shown the expected results in the experimental process,and there are no relevant studies to illustrate the efficacy of small molecule drugs in the treatment of osteoarthritis.(4)Small molecule drugs for the treatment of osteoarthritis have reached the expected experimental results in the basic experimental stage.Numerous studies have exhibited that small molecule drugs can target the suppression of specific proteins,cytokines,and signal transduction pathways that cause osteoarthritis,so as to treat osteoarthritis.Nevertheless,its safety and effectiveness still need to be identified by further basic and clinical studies.This process needs to be investigated and studied by more scholars.(5)At present,many scholars in and outside China have made contributions to the treatment of osteoarthritis.Compared with traditional treatment methods,small molecule drugs reveal better efficacy and safety in the basic experimental stage,and it is expected to become an emerging method for the treatment of osteoarthritis in the future to rid patients of pain.

BACKGROUND:Treadmill training is one of the effective ways to promote the recovery of motor function after spinal cord injury.Treadmill training can promote neurogenesis,but the effect of different intensities of treadmill training on the activation of endogenous stem cells is still unclear. OBJECTIVE:To analyze the activation effect of different intensities of treadmill training on endogenous neural stem cells in the spinal cord of mice after spinal cord injury. METHODS:Fifty female C57BL/6J mice were divided into control group,spinal cord injury group,low-,moderate-,and high-intensity exercise groups with 10 mice in each group by random number table method.T10 segment spinal cord injury model was constructed by the clamp method in spinal cord injury group,low-,moderate-,and high-intensity exercise groups.On day 7 after spinal cord injury,mice in the low-,moderate-,and high-intensity exercise groups were respectively trained on the treadmill with corresponding intensity,3 times/d,10 min/times,6 times a week for 28 consecutive days.At 3,7,14,21,and 28 days after treadmill training,the hind limb motor function was evaluated by BMS score.At 28 days after treadmill training,the spinal cord tissue of the injured area was obtained,and the expression of epidermal growth factor receptor,glial fibrillary acidic protein,and 5-Ethynyl-2'-deoxyuridine(EdU),a proliferative marker,was detected.Hematoxylin-eosin staining was used to observe the morphology of spinal cord. RESULTS AND CONCLUSION:(1)The BMS score of mice in the spinal cord injury group was lower than that in the control group(P<0.05).With the extension of treadmill training time,the BMS scores of mice with spinal cord injury gradually increased,and the BMS scores of mice in moderate-intensity exercise group on days 14 and 21 after treadmill training were higher than those in spinal cord injury group and low-and high-intensity exercise groups(P<0.05).The BMS score of mice in moderate-and high-intensity exercise group was higher than that in spinal cord injury group and low-intensity exercise group at 28 days after treadmill training(P<0.05).(2)Compared with the control group,the proportion of epidermal growth factor receptor and EdU positive cells was increased in spinal cord injury group(P<0.05).Compared with spinal cord injury group,the proportion of epidermal growth factor receptor and EdU positive cells was increased in low-,moderate-,and high-intensity exercise groups(P<0.05),and the highest was found in moderate-intensity exercise group.Compared with control group,the proportion of glial fibrillary acidic protein positive cells was increased in spinal cord injury group(P<0.05).Compared with spinal cord injury group,the proportion of glial fibrillary acidic protein positive cells was lower in low-,moderate-,and high-intensity exercise groups(P<0.05),and the moderate-intensity exercise group was the lowest.(3)Hematoxylin-eosin staining showed that a large cavity was formed in the injured area of mice with spinal cord injury,and the cavity in the injured area of mice with spinal cord injury decreased after different intensities of treadmill training,and the decrease was most obvious in the moderate-intensity exercise group.(4)These results indicate that low-,moderate-,and high-intensity treadmill training can promote the recovery of motor function of mice with spinal cord injury by activating endogenous neural stem cells,and the effect of moderate-intensity exercise training is the most obvious.

OBJECTIVE To investigate the efficacy and safety of ivabradine in the treatment of end-stage renal disease patients with chronic heart failure （CHF） during maintenance hemodialysis （MHD）. METHODS End-stage renal disease patients with CHF during MHD who were treated in our hospital from May 2021 to September 2023 and met the inclusion criteria were selected as the study subjects. They were randomly divided into control group and observation group， with 60 cases in each group， using a random number table method. Both groups of patients received MHD three times a week for 4 hours each time and were anticoagulated with low-molecular weight heparin sodium. At the same time， they were treated with CHF conventional therapy； based on the above treatment， observation group was orally administered Ivabradine tablets 5 mg， twice a day （if the resting heart rate was above 60 beats/min after 2 weeks， the drug dose was increased to 7.5 mg， twice a day）. Both groups of patients were treated continuously for 6 months. The clinical efficacy of 2 groups was compared as well as vital signs， cardiac function， the levels of heart failure- related biomarkers and inflammatory factors before and after treatment， and the incidences of dialysis-related hypotension and adverse drug reactions. RESULTS The effective rate of the observation group （92.45%） was significantly higher than that of the control group （76.47%）， and the incidence of dialysis-related hypotension （20.75%） was significantly lower than that of the control group （41.18%） （P＜0.05）. The heart rate， the levels of left ventricular end-systolic diameter， left ventricular end-diastolic diameter， serum N-terminal pro-B-type natriuretic peptide， cancer antigen 125， tumor necrosis factor-α， interleukin-6， and hypersensitive C-reactive protein in observation group after treatment were significantly lower than those of control group （P＜0.05）； the left ventricular ejection fraction and cardiac output were significantly higher than those in the control group （P＜0.05）. There was no statistically significant difference in the diastolic blood pressure， systolic blood pressure， or the total incidence of adverse drug reactions between the two groups after treatment （P＞0.05）. CONCLUSIONS Ivabradine can significantly improve cardiac function， inhibit ventricular remodeling， down-regulate serum levels of serum N-terminal pro-B-type natriuretic peptide and cancer antigen 125， decrease body inflammation levels and the incidence of dialysis-related hypotension in end-stage renal disease patients with CHF during MHD， with significant clinical effects and good safety.

The innate immune system can be boosted in response to subsequent triggers by pre-exposure to microbes or microbial products, known as “trained immunity”. Compared to classical immune memory, innate trained immunity has several different features. Firstly, the molecules involved in trained immunity differ from those involved in classical immune memory. Innate trained immunity mainly involves innate immune cells (e.g., myeloid immune cells, natural killer cells, innate lymphoid cells) and their effector molecules (e.g., pattern recognition receptor (PRR), various cytokines), as well as some kinds of non-immune cells (e.g., microglial cells). Secondly, the increased responsiveness to secondary stimuli during innate trained immunity is not specific to a particular pathogen, but influences epigenetic reprogramming in the cell through signaling pathways, leading to the sustained changes in genes transcriptional process, which ultimately affects cellular physiology without permanent genetic changes (e.g., mutations or recombination). Finally, innate trained immunity relies on an altered functional state of innate immune cells that could persist for weeks to months after initial stimulus removal. An appropriate inducer could induce trained immunity in innate lymphocytes, such as exogenous stimulants (including vaccines) and endogenous stimulants, which was firstly discovered in bone marrow derived immune cells. However, mature bone marrow derived immune cells are short-lived cells, that may not be able to transmit memory phenotypes to their offspring and provide long-term protection. Therefore, trained immunity is more likely to be relied on long-lived cells, such as epithelial stem cells, mesenchymal stromal cells and non-immune cells such as fibroblasts. Epigenetic reprogramming is one of the key molecular mechanisms that induces trained immunity, including DNA modifications, non-coding RNAs, histone modifications and chromatin remodeling. In addition to epigenetic reprogramming, different cellular metabolic pathways are involved in the regulation of innate trained immunity, including aerobic glycolysis, glutamine catabolism, cholesterol metabolism and fatty acid synthesis, through a series of intracellular cascade responses triggered by the recognition of PRR specific ligands. In the view of evolutionary, trained immunity is beneficial in enhancing protection against secondary infections with an induction in the evolutionary protective process against infections. Therefore, innate trained immunity plays an important role in therapy against diseases such as tumors and infections, which has signature therapeutic effects in these diseases. In organ transplantation, trained immunity has been associated with acute rejection, which prolongs the survival of allografts. However, trained immunity is not always protective but pathological in some cases, and dysregulated trained immunity contributes to the development of inflammatory and autoimmune diseases. Trained immunity provides a novel form of immune memory, but when inappropriately activated, may lead to an attack on tissues, causing autoinflammation. In autoimmune diseases such as rheumatoid arthritis and atherosclerosis, trained immunity may lead to enhance inflammation and tissue lesion in diseased regions. In Alzheimer’s disease and Parkinson’s disease, trained immunity may lead to over-activation of microglial cells, triggering neuroinflammation even nerve injury. This paper summarizes the basis and mechanisms of innate trained immunity, including the different cell types involved, the impacts on diseases and the effects as a therapeutic strategy to provide novel ideas for different diseases.

OBJECTIVE To investigate the effects and mechanism of asperuloside （Asp） on the pyroptosis of intestinal epithelial cells in rats with ulcerative colitis （UC）. METHODS The male SD rats were randomly divided into Control group， model group （UC group）， ASP low-dose and high-dose groups [Asp-L， Asp-H groups， Asp 35， 70 mg/（kg·d）]， ASP high-dose group+AMPK inhibitor Compound C group [Asp-H+Compound C group， Asp 70 mg/（kg·d）+Compound C 0.2 mg/（kg·d）]， with 12 rats in each group. Except for Control group， the other groups were injected with 50% ethanol （0.25 mL）+5% 2，4， 6- trinitrobenzene sulfonic acid solution （2 mL/kg） into the intestinal cavity to construct UC model. After modeling， the rats in each drug group were given corresponding drug solution by gavage or （and） tail vein injection， once a day， for 14 consecutive days. After the last administration， the weight of rats in each group was measured， and the length of their colons was measured； disease activity index （DAI） score and colonic mucosal damage index （CMDI） score were performed， and the serum levels of inflammatory factors （interleukin-18， -1β， -6） were detected. The pathological changes of the colon tissue were observed. The expressions of pyroptosis-related proteins [caspase-1， gasdermin D （GSDMD）] in colon tissue， and pathway-related proteins such as adenosine monophosphate-activated protein kinase （AMPK）， thioredoxin-interacting protein （TXNIP）， NOD-like receptor protein 3 （NLRP3） and apoptosis-associated speck-like protein containing a CARD （ASC） were all detected. RESULTS Compared with Control group， the colon tissue structure of rats in UC group was damaged， with obvious infiltration of inflammatory cells and edema. Their body weight， colon length and phosphorylation level of AMPK protein were significantly reduced or shortened； DAI and CMDI scores， serum levels of inflammatory factors， and the protein expressions of caspase-1， GSDMD， TXNIP， NLRP3 and ASC in colon tissue were increased or upregulated significantly （P＜0.05）. Compared with UC group， the pathological damage of colon tissue in rats was relieved in Asp-L and Asp-H groups， and all quantitative indicators were significantly improved （P＜0.05）； the improvement effect of Asp-H group was more significant （P＜0.05）. Compound C could significantly reverse the improvement effect of high-dose of Asp on the above indicators in UC rats （P＜0.05）. CONCLUSIONS Asp can improve inflammatory damage in colon tissue and inhibit pyroptosis of intestinal epithelial cells in UC rats， which is associated with the activation of AMPK and inhibition of TXNIP/NLRP3 signaling pathway.

OBJECTIVE To investigate the effects and mechanism of asperuloside （Asp） on the pyroptosis of intestinal epithelial cells in rats with ulcerative colitis （UC）. METHODS The male SD rats were randomly divided into Control group， model group （UC group）， ASP low-dose and high-dose groups [Asp-L， Asp-H groups， Asp 35， 70 mg/（kg·d）]， ASP high-dose group+AMPK inhibitor Compound C group [Asp-H+Compound C group， Asp 70 mg/（kg·d）+Compound C 0.2 mg/（kg·d）]， with 12 rats in each group. Except for Control group， the other groups were injected with 50% ethanol （0.25 mL）+5% 2，4， 6- trinitrobenzene sulfonic acid solution （2 mL/kg） into the intestinal cavity to construct UC model. After modeling， the rats in each drug group were given corresponding drug solution by gavage or （and） tail vein injection， once a day， for 14 consecutive days. After the last administration， the weight of rats in each group was measured， and the length of their colons was measured； disease activity index （DAI） score and colonic mucosal damage index （CMDI） score were performed， and the serum levels of inflammatory factors （interleukin-18， -1β， -6） were detected. The pathological changes of the colon tissue were observed. The expressions of pyroptosis-related proteins [caspase-1， gasdermin D （GSDMD）] in colon tissue， and pathway-related proteins such as adenosine monophosphate-activated protein kinase （AMPK）， thioredoxin-interacting protein （TXNIP）， NOD-like receptor protein 3 （NLRP3） and apoptosis-associated speck-like protein containing a CARD （ASC） were all detected. RESULTS Compared with Control group， the colon tissue structure of rats in UC group was damaged， with obvious infiltration of inflammatory cells and edema. Their body weight， colon length and phosphorylation level of AMPK protein were significantly reduced or shortened； DAI and CMDI scores， serum levels of inflammatory factors， and the protein expressions of caspase-1， GSDMD， TXNIP， NLRP3 and ASC in colon tissue were increased or upregulated significantly （P＜0.05）. Compared with UC group， the pathological damage of colon tissue in rats was relieved in Asp-L and Asp-H groups， and all quantitative indicators were significantly improved （P＜0.05）； the improvement effect of Asp-H group was more significant （P＜0.05）. Compound C could significantly reverse the improvement effect of high-dose of Asp on the above indicators in UC rats （P＜0.05）. CONCLUSIONS Asp can improve inflammatory damage in colon tissue and inhibit pyroptosis of intestinal epithelial cells in UC rats， which is associated with the activation of AMPK and inhibition of TXNIP/NLRP3 signaling pathway.