1.Analysis of PM2.5 pollution in Urumqi City from 2016 to 2023 and construction of a prediction model
CHEN Peidi ; XIAO Tingting ; LI Xinxiu ; ZHENG Shuaiyin ; HUANG Yun
Journal of Preventive Medicine 2024;36(6):510-513
Objective:
To analyze the characteristics of fine particulate matter (PM2.5) pollution in Urumqi City, Xinjiang Uygur Autonomous Region from 2016 to 2023 and establish a prediction model, so as to provide the reference for air pollution prevention and control.
Methods:
PM2.5 monitoring data of Urumqi City from 2016 to 2023 were collected through the website of Ministry of Ecology and Environment of China. The changing trend of PM2.5 concentration was analyzed using temporal chart and seasonal index. PM2.5 monthly average concentrations from 2016 to 2023 were used to establish an autoregressive integrated moving average (ARIMA) model, and the data in 2023 was fitted and compared with the actual values, using mean absolute percentage error (MAPE) to evaluate the effectiveness of the model, and PM2.5 monthly average concentration from 2024 to 2025 was predicted.
Results:
PM2.5 daily average concentration in Urumqi City showed a decreasing trend from 2016 to 2023 (rs=-0.239, P<0.001), with high seasonal indexes in January, February and December, indicating certain seasonal characteristics. The optional model was ARIMA (1, 0, 0) (1, 1, 0)12, with the value of Akaike information criterion, corrected Akaike information criterion, and Bayesian information criterion being 727.38, 727.88 and 737.10, respectively. PM2.5 monthly average concentration in 2023 was fitted and compared with the actual values, with an absolute error range of 0.31-7.45 μg/m3, a relative error range of 0.01-0.53, and MAPE of 14.42%. PM2.5 monthly average concentration in Urumqi City from 2024 to 2025 was predicted to be consistent with the trend from 2016 to 2023.
Conclusions
PM2.5 concentration in Urumqi City showed a tendency towards a decline from 2016 to 2023, and was relatively high in winter. ARIMA (1, 0, 0) (1, 1, 0)12 can be used for short-term prediction of PM2.5 pollution in Urumqi City.
2.Influence of social medical insurance treatment policy for specific chronic diseases on medication compliance in patients with primacy hypertension in Guangzhou
Qiuying LING ; Mao MA ; Jinxin ZHANG ; Xi ZHANG ; Xiao WANG ; Murui ZHENG ; Xinxiu LI
Chinese Journal of Practical Nursing 2009;25(23):69-71
Objective To evaluate the influence of social medical insurance treatment policy for specific chronic diseases on medication compliance in patients with primary hypertension in Guangzhou. Methods Questionnaire investigation was adopted to evaluate 219 patients with primary hy-pertension about medication compliance and relevant factors. Results Statistical analysis showed that the patients who enjoyed the policy were better than before in the medication compliance, the treatment satis-faction, the situation of discussing treatment projects with doctors. Conclusions "Treatment policy" facilitates improvement of medication compliance in padents with primary hypertension.
3.Susceptibility Analysis of 249 Enterococcus Strains
Qinchun LI ; Yanping LUO ; Jiyong YANG ; Liyan YE ; Xinxiu LIANG ; Ying ZHANG
Chinese Journal of Nosocomiology 2006;0(07):-
OBJECTIVE To investigate the susceptibility of Enterococcus faecalis and E.faecium isolated from system and urinary tract infected patients and provide data for anti-infection therapy.METHODS The susceptibility(MIC) of 249 Enterococcus strains was tested by agar dilution method.RESULTS All 249 strains of Enterococcus(117 strains of E.faecalis and 132 strains of E.faecium) were isolated from urinary tract or systemic infection patients.The isolated rate of E.faecalis(68.4%) was higher than that of E.faecium(50.0%) in urinary tract isolates.Meanwhile,the isolated rate of E.faecium(50.0%) was obviously higher than that of E.faecalis(31.6%) in systemic infection isolates.The drug susceptibility rate of E.faecalis was higher than that of E.faecium to gatifloxacin,ciprofloxacin,penicillin,ampicillin and high-level gentamicin but lower for minocycline.All Enterococcus were susceptible to vancomycin,teicoplanin and linezolid.They were almost 100.0% resistant to erythromycin.The susceptibility rate of E.faecalis(39.5%)was higher than E.f aecium(15.3%) to high-level gentamicin.The susceptibility rate of E.faecalis isolated from blood was higher than the strains isolated from urinary tract to all antibiotics.E.faecium isolated form blood was almost 100% resistant to gatifloxacin,ciprofloxacin,penicillin,ampicillin and erythromycin.CONCLUSIONS The drug susceptibility of E.faecalis and E.faecium which cause systemic and urinary tract infection is different.The available therapy project should be selected based on the resistance character.At present,vancomycin,teicoplanin and linezolid are the best choice for treatment against the infection caused by Enterococcus.
4.Comparison of Mutant Prevention Concentrations of 3 Fluoroquinolones in 104 Escherichia coli Isolates
Yanping LUO ; Qinchun LI ; Liyan YE ; Zhongqiang YAN ; Xinxiu LIANG ; Leili WANG ; Hongmei JU
Chinese Journal of Nosocomiology 2009;0(17):-
0.05).Our results showed that,for recommended oral doses of ciprofloxacin and moxifloxacin,44.2% of E.coli isolates from the intestine of the health population,and 29.5%,18.7% and 10.7% of isolates from the three sterile sites of the patients,would be selected as resistant mutants.When ciprofloxacin and moxifloxacin were taken by injection route,the ratio of the selection of resistant mutants would be 9.3% for E.coli isolates from the intestine of the health population and 8.2%,6.2% and 8.9% for the three sterile sites of the patients,respectively.The maximum attainable concentration of levofloxacin in serum showed little distinction between the oral and the other routes.CONCLUSIONS The values of MIC and MPC of three fluoroquinolones in E.coli isolates from different populations and sites show no association.The values of MPC couldn't be predicted by the MIC.The values of MPC and MPC90 of three drugs show no significant discrepancy for tested isolates,these E.coli strains are isolated from the intestine of heath persons,and from the blood,ascites,bile of patients.
5.Gemcitabine in the treatment of relapsed or refractory non-Hodgkin's lymphoma.
Shudong MA ; Xinxiu SHENG ; Rongcheng LUO ; Aimin LI
Chinese Journal of Oncology 2002;24(6):619-620
OBJECTIVETo evaluate the efficacy and drug-related toxicity of combined gemcitabine, cisplatin, and prednisone for the treatment of patients with relapsed or refractory aggressive non-Hodgkin's lymphoma (NHL).
METHODSFifteen patients with histologically confirmed relapsed or refractory aggressive NHL were included in this study. Gemcitabine was given on D1, 8 of a three to four weeks schedule at a dose of 1000 mg/m(2) intravenously over 30 minutes for no less than three cycles, and cisplatin was given on D1-3 at a dose of 25 mg/m(2). Prednisone was taken orally on D1-5 at a dose of 60 mg/m(2).
RESULTSOf 15 patients, 11 patients (73.3%) showed responses: 5 patients (33.3%) giving complete response and 6 patients (40.0%) partial response. Four patients' symptoms disappeared, and 1 in 6 patients was alleviated of type B symptoms. Drug-related toxic effects of chemotherapy were mild gastrointestinal reactions in most patients and severe bone marrow depression in very few patients.
CONCLUSIONThe present combination of gemcitabine, cisplatin, prednisone possesses moderate short-term efficacy, acceptable toxicity, and alleviation of suffering related to the disease. This protocol is worthy to be warranted as salvage for relapsed or refractory aggressive NHL.
Adolescent ; Adult ; Aged ; Antimetabolites, Antineoplastic ; administration & dosage ; adverse effects ; Antineoplastic Combined Chemotherapy Protocols ; adverse effects ; therapeutic use ; Cisplatin ; administration & dosage ; Deoxycytidine ; administration & dosage ; adverse effects ; analogs & derivatives ; Female ; Humans ; Lymphoma, Non-Hodgkin ; drug therapy ; Male ; Middle Aged ; Prednisone ; administration & dosage ; Salvage Therapy ; Secondary Prevention
6.Quantitative Susceptibility Mapping of Brain Iron Deposition in Patients With Recurrent Depression
Xinxiu DUAN ; Yuhang XIE ; Xiufang ZHU ; Lei CHEN ; Feng LI ; Guoquan FENG ; Lei LI
Psychiatry Investigation 2022;19(8):668-675
Objective:
Recurrence is the most significant feature of depression and the relationship between iron and recurrent depression is still lack of direct evidence in vivo.
Methods:
Twenty-one patients with depression and twenty control subjects were included. Gradient-recalled echo, T1 and T2 images were acquired using a 3.0T MRI system. After quantitative susceptibility mapping were reconstructed and standardized, a whole-brain and the regions of interest were respectively analyzed.
Results:
Significant increases in susceptibility were found in multiple recurrent depression patients, which involved several brain regions (frontal lobes, temporal lobe structures, occipital lobes hippocampal regions, putamen, thalamus, cingulum, and cerebellum). Interestingly, no susceptibility changes after treatment compared to pre-treatment (all p>0.05) and no significant correlation between susceptibility and Hamilton Depression Rating Scale were found. Besides, it was close to significance that those with a higher relapse frequency or a longer mean duration of single episode had a higher susceptibility in the putamen, thalamus, and hippocampus. Further studies showed susceptibility across the putamen (ρ2=0.27, p<0.001), thalamus (ρ2=0.21, p<0.001), and hippocampus (ρ2=0.19, p<0.001) were strongly correlated with total course of disease onset.
Conclusion
Brain iron deposition is related to the total course of disease onset, but not the severity of depression, which suggest that brain iron deposition may be a sign of brain damage in multiple recurrent depression.
7.Evaluation on survival in locally advanced non-small cell lung cancer (NSCLC) for multimodality treatment with or without operation.
Jinhan LI ; Shudong MA ; Shijun KANG ; Jianming XIE ; Xinxiu SHENG ; Rongcheng LUO
Chinese Journal of Lung Cancer 2005;8(6):535-537
BACKGROUNDIt is uncertain that the effect of multimodality treatment with operation on survival for locally advanced non-small cell lung cancer (NSCLC). The aim of this study is to evaluate the effect of multimodality treatment with or without operation on survival for locally advanced NSCLC.
METHODSFrom May 1992 to May 1999, 114 patients with locally advanced NSCLC were divided into two arms. Arm A (n=56): 39 cases were at stage IIIA, and 17 at stage IIIB; Median KPS was 80 (range from 70 to 90 ); Multimodality treatment program included operation, chemotherapy, radiotherapy and traditional Chinese herb medicine. Of them, lobectomy plus mediastinal systematic lymph node dissection or lymph node sampling accounted for 49 cases, sleeve lobectomy plus mediastinal lymph node dissection for 5 cases, and pneumonectomy for 2 cases. Preoperative or adjuvant chemotherapy regimens included MVP (mitomycin C, vindesine, cisplatin), NP (vinorelbine, cisplatin), TC (paclitaxel, carboplatin), GP (gemcitabine, cisplatin), which were repeated every 4 weeks for 4-6 cycles. Total dose of radiotherapy for lesions in the lung or mediastinal field was 5000-6000cGy. Arm B (n=58): 23 cases were at stage IIIA, and 35 at stage IIIB; Median KPS was 70 (range from 60 to 90); Treatment program was the same approximately as arm A except for no operation.
RESULTSArm A: (1) Metastatic locations in follow-up, in turn, showed as: lymph node, pleural-lung, bone, brain, liver, pericardium, skin and adrenal; (2) Median survival was 27 months, and 1-, 2- and 5-year survival rate was 82.1%, 60.7% and 25.0% respectively. Arm B: (1) Metastatic locations in follow-up, in turn, showed as: lymph node, pleural-lung, bone, brain, liver, pericardium, skin, adrenal, pancreatic and esophageal metastasis; (2) Median survival was 13 months, and 1-, 2- and 5-year survival rate was 53.4%, 31.0% and 1.7% respectively. Median survival duration of Arm A was significantly superior to Arm B (P=0.0001). There were significant differences in 1-, 2- and 5-year survival rate between the two groups (Chi-Square=9.4, P < 0.01; Chi-Square=8.9, P < 0.01;Chi-Square=11.5, P < 0.01).
CONCLUSIONSCompared with non-operative multimodality treatment, operative multimodality treatment including lobectomy or pneumonectomy with mediastinal lymph node dissection can remarkably improve the survival in patients with locally advanced NSCLC.
8.The effect of intrinsic capacity and comorbidity on adverse outcomes in community-dwelling older adults: path analysis based on structure equation model
Shuo LIU ; Xiaohong LIU ; Lin KANG ; Shan JIANG ; Jiaojiao LI ; Xinxiu YU
Chinese Journal of Geriatrics 2024;43(3):366-371
Objective:To examine the impact of intrinsic capacity(IC), comorbidity, and their interaction on the occurrence of adverse outcomes in community-dwelling older adults.Methods:This 2-year observational cohort study included 230 residents aged 75 and above who lived in the Beijing Taikang Yanyaun community active area from June to August 2018.The study evaluated the IC scale, Charlson comorbidity index(CCI), and activity of daily living(ADL).In September 2020, adverse outcomes such as functional decline(defined as a decline of at least one point on the ADL scores at 2-year follow-up compared with baseline)and falls were assessed.The structure equation model(SEM)path analysis was employed to examine the direct and indirect effects of IC and CCI on adverse outcomes.Results:Among the 212 older adults who completed a 2-year follow-up, aged 75-93(mean age 83.8±4.4)years, 59.4%(126 cases)were female.Out of these participants, 51.4%(109 cases)experienced functional decline and 33.5%(71 cases)had falls.Path analysis revealed that the direct effects of IC on functional decline and falls were significantly positive, with standardized coefficients of 0.430 and 0.369, respectively.However, the effect of CCI was not found to be significant.The multi-variable Logistic regression model showed that the total effect of IC on functional decline and falls remained significantly positive, with values of 1.184 and 0.915, respectively.CCI acted as a mediating factor, with indirect effects on functional decline and falls accounting for 5.4% and 0.8%, respectively.In terms of the relationship between age and adverse outcomes, the indirect effect of IC was significantly higher than that of CCI(functional decline: 0.192 vs.0.037; falls: 0.158 vs.0.017). Conclusions:The maintenance of IC in the health management of community-dwelling older adults should be given more attention as it can significantly affect the incidence of functional decline and falls.Comorbidity, on the other hand, has a weaker influence.
9.Confirmatory factor analysis of the Montreal Cognitive Assessment in evaluating elderly mild cognitive impairment
Xinxiu DONG ; Hui HU ; Ling WANG ; Yating AI ; Chongming YANG ; Kaili SUN ; Yirong SHI ; Mengying LI
Chinese Journal of Neurology 2018;51(12):966-971
Objective To assess the psychometric potential of the Montreal Cognitive Assessment Scale-Beijing (MoCA-BJ) as a screening instrument for mild cognitive impairment (MCI) in older adults in Wuhan communities of central China. Methods MoCA-BJ and Mini-Mental State Examination (MMSE) were adopted to assess the MCI of 381 older adults from 13 communities in Wuhan in 2015. Confirmatory factor analysis was conducted to evaluate the construct validity of MoCA-BJ, and the relationship between all aspects of cognitive function and MoCA different dimensions. Results MoCA-BJ had acceptable reliability (w=0.76), and MoCA-BJ and MMSE estimation results were highly correlated (r=0.73, P<0.01). By comparing three measurement models through confirmatory factor analysis, we found that the MoCA-BJ scale had two factors (F1: visual space executive function, F2: memory-based other cognitive functions) in model 3, fit degree of which was higher than model 1 by one factor, and there was a statistically significant difference in the number of factors between model 1 and model 3 (χ2dif=8.73,P<0.01). Conclusions The MoCA-BJ has two underlying factors that respectively represent two highly correlated but distinct factors, cognition and visual-spatial. Uninformative items should be revised with culturally sensitive items and the cut-off point for mild impairment should also be altered.
10.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.