Objective To evaluate the theoretical knowledge level of Chinese nursing students based on the problem-based learning(PBL)versus traditional teaching methods. Methods Databases including CNKI (1979-2013.03),VIP (1989-2013.03)and Wanfang (1982-2013.03)were searched (up to March,2013)for controlled studies comparing PBL and traditional teaching methods. The quality of included studies was critically evaluated and the data were analyzed by Stata 10.0 software. Results A total of 659 articles were retrieved but only 22 were included. Meta-analyses showed that there were significant differences between PBL and traditional teaching methods in improving theoreti-cal knowledge of nursing students(SMD merge=0.79,95%CI(0.55,1.03),P=0.000). Conclusions PBL can improve the theoretical scores of Chinese nursing students. However,the above conclusion needs to be confirmed by more large-scale randomized controlled trials of higher quality due to the limitation of studies include in this paper.

OBJECTIVE:To investigate the effect of edelfosine on the proliferation of Hela cells and its mechanism.METHODS:Hela cells were treated with edelfosine at doses of 0(control),0.5,1.0,5.0,10.0 ?mol?L-1 for 96 h.MTT assay,flow cytometry,and staining were performed to determine the cell proliferation activity,cell cycle,and apoptotic rate.RESULTS:As compared with control,the cell proliferation activity of Hela cells was inhibited in a dose-and time-dependent manner after being treated by edelfosine for 24～96 h.After being treated by edelfosine(1.0,5.0,10.0 ?mol?L-1) for 72 h,the number of Hela cells significantly increased in G0/G1 phase but decreased in S phase(P

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

OBJECTIVETo establish an LC-MS method for rapid simultaneous determination of adenine,adenosine and cordycepin in Cordyceps sinensis.

METHODAn electrospray ionization (ESI) interface and selective ion monitoring (SIM) mode were used. The analytical column was a Shimadzu VP-ODS column (2.0 mm x 150 mm) and the mobile phase was water-methanol-formic acid (92:7:1). Methanol was used as extraction solvent and 2-chloroadenosine was used as internal standard for this assay.

RESULTThe regression equations and coefficient were Y = 0.07264X + 0.00622 and r = 0.9987 for adenine, Y = 0.1597X + 0.0146 and r = 0.9991 for adenosine, Y = 0.1942X + 0.0186 and r = 0.9994 for cordycepin. The linear range was 0.8-130.0 mg x L(-1), 0.5 - 124.5 mg x L(-1) and 0.5-128.5 mg x L(-1) for adenine, adenosine and cordycepin, respectively. The average recovery was 98.76%, 99.37% and 99.26% for adenine, adenosine and cordycepin, respectively.

CONCLUSIONThis established method was highly sensitive, fast and selective, which can be used for rapid simultaneous determination of adenine, adenosine and cordycepin in C. sinensis. This method also can be applied for the quality control of C. sinensis.

Animals ; Chromatography, Liquid ; methods ; Cordyceps ; chemistry ; Moths ; chemistry ; Nucleosides ; chemistry ; Sensitivity and Specificity ; Spectrometry, Mass, Electrospray Ionization ; methods

Objective To investigate the inhibitory effects and mechanisms of α-hederin,an active ingredient in Fruc-tus Akebiae,on hepatocellular carcinoma(HCC)cells.Methods HCC cells were divided into four groups and treated with α-hederin(0,10,20,and 30 μmol·L-1)for 24 h and 48 h,respectively.MTT assays were used to detect the cell proliferation rate,flow cytometry(FCM)was used to detect the apoptotic rate,transcriptomics was used to screen signaling pathways in α-hederin-treated HCC cells,RNA interference was exploited to verify the underlying signaling pathway,and real-time quantitative PCR(qRT-PCR)and Western blotting(WB)were used to detect expression changes of the mRNA and protein of TP53(p53),PMAIP1(Noxa),and apoptosis-associated proteins,Caspase9 and Caspase3.Results α-Hederin induced apoptosis by activa-ting apoptosis-associated proteins,PARP,Caspase9 and Caspase3.Transcriptomics,qRT-PCR,and WB results also showed that α-hederin increased the mRNA and protein expression of p53 and Noxa.Furthermore,α-hederin inhibited the protein degradation of p53 and Noxa,reversing the apoptosis decrease in p53/Noxa siRNA-knocked-down HCC cells.In vivo results showed that α-hederin inhibited the growth of HCC tumors.Conclusion α-hederin may induce the apoptosis of HCC cells by activating and stabilizing the p53/Noxa signaling pathway.

OBJECTIVE：To inv estigate therapeutic efficacy and safety of recombinant human interferon gel combined with Baofukang suppository in the treatment of cervical high-risk human papillomavirus （HPV）infection. METHODS ：Totally 259 patients with persistent high-risk HPV infection diagnosed and treated in gynecology department of the First Affiliated Hospital of Hainan Medical University from Aug. 2017 to Sept. 2019 were selected and divided into interferon group （n＝82），Baofukang suppository group （n＝86）and combination group （n＝91）according to random number table. The patients in interferon group and Baofukang suppository group were given Recombinant human interferon α2b gel 1 g, qd or Baofukang suppository 1 capsule，qd； the patients in combination group were given Recombinant human interferon α2b gel and Baofukang suppository 1 capsule，qd；for 3 months. Then the clinical efficacy ，negative time of HPV ，duration of abnormal secretion ，LCT test results ，cervical inflammation score ，HPV relative light unit/critical value （RLU/CO）and the incidence of ADR were recorded. RESULTS ：The total effective rate of combination group was significantly higher than that of interferon group and Baofukang suppository group ， the negative time of HPV and duration of abnormal secretion in combination group were significantly shorter than interferon group and Baofukang suppository group （P＜0.05）. Before treatment ，the normal rate of LCT of 3 groups were 0，and there was no statistical significance in cervical inflammation score and HPV RLU/CO among 3 groups（P＞0.05）. After treatment ，normal rate of LCT was increased in 3 groups，compared with before treatment （P＜0.05），and normal rate of LCT in combination group was significantly higher than interferon group and Baofukang suppository group. The cervical inflammation score and HPV RLU/CO were significantly lower than before treatment ，and the combination group was significantly lower than interferon group and Baofukang suppository group （P＜0.05）. There was no statistical significance in above indicatora after treatment betwent interferon group and Baofukang suppository group and the incidence of ADR among 3 groups during medication （P＞0.05）. CONCLUSIONS：The application of recombinant human interferon gel combined with Baofukang suppository is effective and safe way in the treatment of cervical high-risk HPV infection.