1.Study on the effect of down-regulation of DNMT1 on cell proliferation,metastasis ability of esophageal squamous cell carcinoma cell line EC9706 cells and its related mechanisms
Ying LIU ; Ke LI ; Wenjing LIU ; Jufeng WANG ; Qingxia FAN
China Oncology 2006;0(11):-
Background and purpose:More and s’more evidence has demonstrated that DNMT1 was expressed at high levels in many different kinds of human tumor tissues or cells,suggesting that high expression of DNMT1 was closely associated with occurrence and development of tumors.In this study,effect of down-regulation of DNMT1 on cell proliferation and migration ability of esophageal squamous cell carcinoma(ESCC) cell line EC9706 cells was studied and its related mechanism was explored.Methods:Cell proliferation assay was investigated using CCK-8 Kit,cell migration ability was analyzed using Boyden chamber and the expressions of DNMT1 and MMP-2 were detected by Real-time PCR and Western blotting methods.Results:The result of cell proliferation experiment showed that down-regulation of DNMT1 could markedly inhibit cell proliferation in EC9706 cells.After transfection with DNMT1 siRNA,invasiveness and metastasis ability of EC9706 cells displayed an obvious decrease(P
2.Expression level and clinical significance of vascular endothelial growth factor and CD44v6 in the diagnosis and treatment of small cell lung cancer
Ming YUAN ; Qiong WANG ; Dan WU ; Jufeng GU
Clinical Medicine of China 2017;33(7):625-627
Objective To analyze the expression level of CD44v6 in small cell lung cancer and the concentration of vascular endothelial growth factor(VEGF) in serum,to explore the clinical significance of them in small cell lung cancer.Methods The expression level of CD44v6 was detected by immunohistochemical methods in 80 cases of small cell lung cancer as patients group,who were treat in People''s Hospital of Jiangyin from January 2014 to January 2016.Another 80 cases of healthy subjects as control group.Used ELISA method to detect the concentration of VEGF of the two groups of patients in the blood.Analyzed the relationship between VEGF,CD44v6 with the survival time of patients.Results The CD44v6 expression in small cell lung cancer was positive in 6 cases,the total positive expression rate was 7.5%.The serum levels of VEGF in patients group((490.9±342.7) ng/L) was significantly different from that in the control group((180.8±67.5) ng/L),and the difference was statistically significant(P=0.024).There was no correlation between the survival time and the expression of CD44v6 in small cell lung cancer(P=0.723).The survival time of small cell lung cancer was negatively correlated with the concentration of VEGF in serum.Conclusion There is a significant correlation between serum VEGF concentration and survival time in patients with small cell lung cancer,which is one of the prognostic factors in patients with small cell lung cancer.
3.Clinical Observation of Docetaxel Combined with Oxaliplatin and Capecitabine in the Treatment of Advanced Gastric Cancer
Xinfang HOU ; Ying LIU ; Wenjing LIU ; Kai ZANG ; Jufeng WANG
China Pharmacy 2005;0(16):-
0.05). The main toxicity reactions were myelosuppression,gastrointestinal reactions,peripheral neurotoxicity and most of the patients can suffer that. CONCLUSION:Docetaxel combined with oxaliplatin and capecitabine have good effect on advanced gastric cancer and are less toxic. It can be the main treatment way to cure advanced gastric cancer.
4.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
5.Laparoscopic hernioplasty in 50 cases.
Cunchuan WANG ; Jufeng QIAO ; Qian LI ; Weichen LIANG ; Jun CHEN ; Yihao XU
Chinese Journal of Practical Surgery 2001;21(2):88-90
ObjectiveTo study the method,indications, advantage and shortcoming of laparoscopic repair of inguinal hernia. MethodsFrom Jun. 1995 to Jun. 2000,50 patients with inguinal hernia were treated with laparoscopy. There were 34 indirect inguinal hernia, 9 direct inguinal hernia and 7 concealed hernia. The transabdominal preperitoneal laparoscopic mesh repair of hernia(TAPP) was performed in 34 patients. Closure of the internal orifice of hernia was performed in 7 patients. Totally extraperitoneal repair was performed in 9 patients. ResultsAll cases were operated successfully. The mean operation time was 59.3(15~180) mins. The average length of postoperative stay was 5.4(3~7)days. There were no death record and no conversion operation. There was one early failure owing to the use of too small a piece of mesh. There has been no long-term recurrence. ConclusionThe results indicate that mesh repair of hernias is a satisfactory technique with a low recurrence rate and a low major complication rate.
7.Nano-hydroxyapatite artificial bone for collapsed fractures of the tibial plateau
Daping WANG ; Jianyi XIONG ; Weimin ZHU ; Jianghong HUANG ; Li DUAN ; Jielin CHEN ; Jufeng ZHANG
Chinese Journal of Tissue Engineering Research 2013;(51):8863-8868
BACKGROUND:Nano-hydroxyapatite helps to improve the mechanical properties of bone implants.
OBJECTIVE:To study the clinical effect of nano-hydroxyapatite artificial bone on col apsed fracture of the tibial plateau.
METHODS:Fourteen cases of col apsed fracture of the tibial plateau combined with bone defects from March 2010 to September 2012 were analyzed retrospectively. The bone defect range was from 1.5 cm×1.0 cm to 3.1 cm×4.5 cm. Al patients were treated with nano-hydroxyapatite artificial bone at an implant amount of 5-14 g. Clinical and X-ray observations were applied at 1 week, 1 month and 3 months postoperatively. Hospital for Special Surgery scores were employed for recovery of knee function.
RESULTS AND CONCLUSION:The patients were fol owed up for 12-27 months. Except for one case of a smal amount of wound exudates, no general side effects occurred in 13 cases. X-ray photo showed an integrity interface between nano-hydroxyapatite artificial bone and host bone at 3 months after treatment. Primary healing was obtained in al cases without any complications. Hospital for Special Surgery score was increased to (88.7±4.3) points at 1 year later. These findings indicate that the nano-hydroxyapatite artificial bone has a good biocompatibility and biomechanics, and it may be an ideal artificial bone for repairing col apsed fractures of the tibial plateau.
8.Treatment of mandibular osteoradionecrosis with submental artery island flap and reconstructive Ti-plate
Jin LI ; Jufeng CHEN ; Jiapeng LI ; Dan XIAN ; Lei WANG ; Junping LAO ; Chunmei YU
Journal of Practical Stomatology 2015;(2):215-218
Objective:To investigate the clinical efficacy of reconstruction of the mandibular defect in patients with osteoradionecro-sis using submental artery island flap and reconstructive Ti-plate.Methods:20 cases with mandible osteoradionecrosis underwent par-tial mandibulectomy.The submental artery island flap and reconstructive Ti-plate were used to reconstruct the mandibular defects and adjacent soft tissue defects.The post-operative effects and flap successful rate were evaluated with a follow-up period of 6 to 1 8 months.Results:1 9 flaps were well survived,local necrosis in the remote end was observed in 1 flap,but survived by hyperbaric ox-ygen therapy and iodoform gauze dressing,no plate exposure was found after operation in the follow up period.All patients were satis-factory with the outlook.Conclusion:Submental artery island flap combined with reconstructive Ti-plate is feasible in the treatment of osteoradionecrosis.
9.Effect of Edelfosine on the Proliferation of Hela Cells and Its Mechanism
Hui ZHANG ; Liping YU ; Jufeng ZHOU ; Dugui HE ; Linzhen LI ; Bin WANG ; Tongxiu LUO ; Qiangguo LI
China Pharmacy 2005;0(22):-
OBJECTIVE:To investigate the effect of edelfosine on the proliferation of Hela cells and its mechanism.METHODS:Hela cells were treated with edelfosine at doses of 0(control),0.5,1.0,5.0,10.0 ?mol?L-1 for 96 h.MTT assay,flow cytometry,and staining were performed to determine the cell proliferation activity,cell cycle,and apoptotic rate.RESULTS:As compared with control,the cell proliferation activity of Hela cells was inhibited in a dose-and time-dependent manner after being treated by edelfosine for 24~96 h.After being treated by edelfosine(1.0,5.0,10.0 ?mol?L-1) for 72 h,the number of Hela cells significantly increased in G0/G1 phase but decreased in S phase(P
10.Expression of metallothionein 1H in children and adolescents osteosarcoma and effect on cell proliferation
Xinfang HOU ; Shuai LI ; Chen WU ; Shuning XU ; Ke LI ; Jufeng WANG
Chinese Journal of Applied Clinical Pediatrics 2017;32(3):208-211
Objective To detect the expression levels of metallothionein1 H(MT1 H)in children and adoles-cents osteosarcoma serums,and to analyze its relationship with clinicopathological features,and to explore the effect of MT1 H on cell proliferation of osteosarcoma cells and its mechanism.Methods Enzyme -linked immuno sorbent assay (ELISA)was performed to detect the expression of MT1 H in children and adolescents osteosarcoma serums and non-neoplastic disease serums.MT1 H vector was transfected into the osteosarcoma U2OS cells.Reverse transcription -poly-merase chain reaction(RT -PCR)and Western blot were used to detect the expression of the mRNA and protein of MT1 H,respectively.Methylthiazolyldiphenyl -tetrazolium bromide(MTT)was used to detect the cell growth.Western blot was performed to detect the expression of nuclear factor(NF)-κB,and inhibitor of κB (IκB)-αprotein. Results The expressions of MT1 H in osteosarcoma serums and nonneoplastic disease serums was (0.51 ± 0.52)μg/L and (2.17 ±0.78)μg/L,respectively,with a significant difference between the 2 groups(t =-8.966, P <0.05).The expression of MT1 H in stage Ⅰ -ⅡA andⅡB -Ⅲ was (1 .98 ±0.69)μg/L and (2.45 ±0.82)μg/L,respectively,showing a gradual increase depending on clinical staging(t =-2.343,P <0.05).The expressions of MT1 H mRNA and protein were elevated in osteosarcoma U2OS cells after MT1 H vector transfection(all P <0.05). MTT assay showed that,the A value in blank control group,blank vector group,MT1 H vector group were 0.38 ±0.03, 0.36 ±0.03,0.42 ±0.03,respectively,the cell proliferation in the MT1 H vector group was significantly promoted when compared with these in the blank vector group and blank control group(F =4.213,P <0.05)from the third day.West-ern blot showed that,the relative expression of NF -κB in blank control group,blank vector group,MT1 H vector group were 0.56 ±0.05,0.53 ±0.05,0.92 ±0.07,respectively,the relative expression of IκB -αprotein were 0.64 ± 0.06,0.62 ±0.09,0.34 ±0.08,respectively,the expression of NF -κB protein was up -regulated and the expression of IκB -αprotein was down -regulated in the MT1 H vector group when compared with those in the blank vector group and blank control group(F =44.581 ,14.927,all P <0.05).Conclusions The expression of MT1 H is increased in children and adolescents osteosarcoma serums compared with that in nonneoplastic disease serums.The clinical stage is later,the expression of MT1 H is higher.MT1 H promotes cell proliferation through regulating the NF -κB pathway.