1.Correlation between neonatal retinal hemorrhage and changes in umbilical artery blood gas analysis
Xianghe HUANG ; Jiyun WANG ; Weiguo YANG ; Ying WANG
International Eye Science 2024;24(5):831-834
AIM: To explore the correlation between neonatal retinal hemorrhage(RH)and changes in umbilical artery blood gas analysis.METHODS: A total of 312 full-term neonates born in our obstetrics department from January 2019 to December 2021 were selected as the study subjects. According to the RetCam III fundus examination results, 245 neonates who did not experience RH were included in the control group, while 67 cases with RH were found to be included in the RH group. In addition, neonates were grouped into I degree group(n=20), II degree group(n=29), and III degree group(n=18)based on the degree of RH. General clinical data and umbilical artery blood gas analysis indicators between the RH group and the control group were compared; the levels of umbilical artery blood gas analysis indicators in neonates with different degrees of RH, the relationship between pH and RH degree, and the influencing factors of neonatal RH were analyzed.RESULTS: There was no obvious difference in maternal age, average gestational week, fetal gender, parity, gestational diabetes, fetal birth weight, and amniotic fluid between the RH group and the control group(all P>0.05), while there were obvious differences in delivery methods, gestational hypertension, forceps assisted delivery, neonatal asphyxia, and umbilical cord around the neck(all P<0.05). The pH value, arterial blood sample partial pressure(PaO2)and base excess(BE)values of the RH group were obviously lower than those of the control group(all P<0.01), while the arterial carbon dioxide partial pressure(PaCO2)was obviously higher than that of the control group(P<0.01). There were obvious differences in umbilical artery blood gas analysis indicators among children with different degrees of RH(P<0.05), and with the increase of the degree of RH, pH value, PaO2 and BE gradually decreased(P<0.05), and PaCO2 gradually increased(P<0.05). There was a negative correlation between the degree of RH and the pH of umbilical artery blood gas analysis(rs=-0.593, P<0.05). The results of multivariate Logistic regression analysis showed that delivery method, gestational hypertension, forceps assisted delivery, neonatal asphyxia, umbilical cord entanglement, pH, PaO2, PaCO2, and BE were all influencing factors for the occurrence of neonatal RH.CONCLUSION: There is a close correlation between neonatal RH and changes in umbilical artery blood gas analysis, and umbilical artery blood gas analysis can be used for the diagnosis of neonatal RH, which can be used to guide clinical treatment.
2.Neoadjuvant Nivolumab Therapy for Esophageal Squamous Cell Carcinoma: A Single-Arm, Phase II Study
Sehhoon PARK ; Yurimi LEE ; Jiyun LEE ; Yang Won MIN ; Hong Kwan KIM ; Joon Young CHOI ; Hyun Ae JUNG ; Yong Soo CHOI ; Yoon-La CHOI ; Young Mog SHIM ; Jong-Mu SUN
Cancer Research and Treatment 2024;56(2):567-579
Purpose:
Programmed death-1/programmed death-ligand 1 (PD-L1) inhibitors have shown efficacy in metastatic esophageal squamous cell carcinoma (ESCC) therapy. However, data is still limited regarding neoadjuvant immunotherapy for operable ESCC.
Materials and Methods:
Patients with clinical stage T2 or T3 and N0 ESCC received three cycles of nivolumab therapy every two weeks before surgical resection. The primary endpoint is major pathologic responses (MPR) rate (≤ 10% of residual viable tumor [RVT]).
Results:
Total 20 patients completed the planned nivolumab therapy. Among them, 17 patients underwent surgery as protocol, showing MPR in two patients (MPR rate, 11.8%), including one pathologic complete response, on conventional pathologic response evaluation. Pathologic response was re-evaluated using the immune-related pathologic response criteria based on immune-related RVT (irRVT). Three patients were classified as immunologic major pathologic response (iMPR; ≤ 10% irRVT, iMPR rate: 17.6%), five as pathologic partial response (> 10% and < 90% irRVT), and nine as pathologic nonresponse (≥ 90% irRVT). The combined positive score (CPS) for PD-L1 in the baseline samples was predictable for iMPR, with the probability as 37.5% in CPS ≥ 10 (3/8) and 0% in CPS < 10 (0/9).
Conclusion
Although the efficacy of neoadjuvant nivolumab therapy was modest in unselected ESCC patients, further researches on neoadjuvant immunotherapy are necessary in patients with PD-L1 expressed ESCC.
3.Mean and Variability of Lipid Measurements and Risk for Development of Subclinical Left Ventricular Diastolic Dysfunction
Jiyun PARK ; Mira KANG ; Jiyeon AHN ; Min Young KIM ; Min Sun CHOI ; You-Bin LEE ; Gyuri KIM ; Kyu Yeon HUR ; Jae Hyeon KIM ; Jeong Hoon YANG ; Sang-Man JIN
Diabetes & Metabolism Journal 2022;46(2):286-296
Background:
Subclinical left ventricular diastolic dysfunction (LVDD) is an emerging consequence of increased insulin resistance, and dyslipidemia is one of the few correctable risk factors of LVDD. This study evaluated the role of mean and visit-to-visit variability of lipid measurements in risk of LVDD in a healthy population.
Methods:
This was a 3.7-year (interquartile range, 2.1 to 4.9) longitudinal cohort study including 2,817 adults (median age 55 years) with left ventricular ejection fraction >50% who underwent an annual or biannual health screening between January 2008 and July 2016. The mean, standard deviation (SD), coefficient of variation (CV), variability independent of the mean (VIM), and average real variability of total cholesterol, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), apolipoprotein B (apoB), non-HDL-C, and triglycerides were obtained from three to six measurements during the 5 years preceding the first echocardiogram.
Results:
Among the 2,817 patients, 560 (19.9%) developed LVDD. The mean of no component of lipid measurements was associated with risk of LVDD. CV (hazard ratio [HR], 1.35; 95% confidence interval [CI], 1.10 to 1.67), SD (HR, 1.27; 95% CI, 1.03 to 1.57), and VIM (HR, 1.26; 95% CI, 1.03 to 1.55) of LDL-C and all the variability parameters of apoB were significantly associated with development of LVDD. The association between CV-LDL and risk of LVDD did not have significant interaction with sex, increasing/decreasing trend at baseline, or use of stain and/or lipid-modifying agents.
Conclusion
The variability of LDL-C and apoB, rather than their mean, was associated with risk for LVDD.
4.Association between arsenic exposure and spontaneous abortion: a review of epidemiological studies
Hang PEI ; Zhibin MA ; Jiyun LIAO ; Chen YANG ; Xingrong LIU
Journal of Preventive Medicine 2022;34(10):1011-1015
Abstract:
Arsenic and arsenic compounds have been listed as one of the toxic and harmful environment pollutants, and drinking, seafood intake, use of skincare products and inhalation of tobacco smoke are main routes of exposure to human arsenic exposure. The adverse effects of arsenic on pregnant outcomes have been paid much attention. Prenatal exposure to high-level arsenic has been found to increase the risk of spontaneous abortion among pregnant women. Based on national and international epidemiological studies on the correlation between arsenic exposure and spontaneous abortion during the period between 1992 and 2020, we review the association between arsenic exposure and spontaneous abortion and describe the mechanisms underlying spontaneous abortion caused by arsenic exposure, so as to provide insights into early prevention of spontaneous abortion.
5.Machine learning-based prediction of long-term mortality in patients with atrial fibrillation and coronary heart disease aged 60 years and over
Min DONG ; Tong ZOU ; Bingfeng PENG ; Jiyun SHI ; Lei XU ; Zuowei PEI ; Yimei QU ; Meihui ZHANG ; Fang WANG ; Jiefu YANG
Chinese Journal of Geriatrics 2022;41(7):804-810
Objective:To establish a long-term mortality rate prediction model for patients aged 60 years and over with atrial fibrillation and coronary heart disease using the machine learning method, and identify the corresponding risk factors of mortality.Methods:In this retrospective cohort study, a total of 329(11 cases lost of follow-up)patients with 183 males(55.6%)and 146 females(44.4%), aged(77.8±7.3)years, and 142 patients aged 80 years or older(43.2%)were selected in our hospitals from January 2013 to March 2015.And their clinical data on atrial fibrillation and coronary heart disease were analyzed.They were divided into the death group(151 cases)and the survival group(167 cases)according to the survival outcome.In addition, 60 patients aged 60 years and over admitted to our hospitals from April to July 2015 with atrial fibrillation and coronary heart disease were selected as external data validation set.The clinical data included age, gender, body mass index, diagnosis, co-morbidity, laboratory indicators, electrocardiogram, echocardiogram, treatment data.These patients were followed up for at least 6 years, and the main adverse cardiovascular and cerebrovascular events(MACCE), including death, were recorded.Finally, the data of the enrolled patients were randomly divided into the training set and the test set according to the ratio of 9∶1, Different models were established to predict the long-term mortality of patients with atrial fibrillation and coronary heart disease by machine learning algorithm.The optimal model was established by substituting external data(60 cases)into the model for verification and comparison.The top 20 risk factors for mortality were determined by Shapley additive explanation(SHAP)algorithm.Results:A total of 329 hospitalized patients were included in this study, the overall median follow-up time was 77.0 months(95% CI: 54.0~84.0), 11 cases lost during follow-up(3.3%), and 151 cases died(45.9%). The analysis found that the areas under the ROC curve for a support vector machine(SVM)model, k-Nearest Neighbor(KNN)model, decision tree model, random forest model, ADABoost model, XGBoost model and logistic regression model were 0.76, 0.75, 0.75, 0.91, 0.86, 0.85 and 0.81, respectively.The random forest model had the highest prediction efficiency, with the accuracy of 0.789 and F1 value of 0.806, which was better than the logistic regression model[the Area Under Receiver Operating Characteristic Curve(AUC): 0.91 vs.0.81, P<0.05]. D-dimer, age, number of MACCE, left ventricular ejection fraction, serum albumin level, anemia, New York Heart Association(NYHA)grade, history of old myocardial infarction, estimated glomerular filtration rate(eGFR)and resting heart rate were important risk factors for predicting long-term mortality. Conclusions:The random forest model based on machine learning method can predict the long-term mortality of patients with atrial fibrillation and coronary heart disease aged 60 years and over, have a good identification ability.Its accuracy is higher than that of the traditional Logistic regression model.Reducing the long-term mortality and improving the long-term outcomes can be achieved by intervening on D-dimer levels, correcting hypoproteinemia and anemia, improving cardiac function and controlling resting ventricular rates.
6.Analysis of clinical phenotype and genetic variants in a Chinese pedigree affected with Angelman syndrome.
Wei JIANG ; Li CAO ; Jing YU ; Xiaoxue NA ; Jiyun YANG
Chinese Journal of Medical Genetics 2021;38(8):723-726
OBJECTIVE:
To explore the genetic etiology for a Chinese pedigree affected with Angelman syndrome (AS).
METHODS:
The proband with phenotypes suggestive of AS was subjected to copy number variation sequencing (CNV-seq), methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) and high-throughput next generation sequencing (NGS). Variant of the UBE3A gene was verified among family members by Sanger sequencing and bioinformatic analysis.
RESULTS:
NGS revealed that the proband has carried a heterozygous variant of the UBE3A gene, namely c.1517G>A (p.R506H). The variant has co-segregated with the disease in the pedigree. Multiple amino acid sequence alignment showed that the site of mutant residue is conserved among nine homologous species. The variant was predicted to be deleterious by bioinformatic analysis.
CONCLUSION
A novel variant of the UBE3A gene has been identified in a Chinese pedigree affected with AS. Above finding has further expanded the spectrum of UBE3A gene variants and phenotypes of AS, which also facilitated molecular diagnosis and genetic counseling for the family.
Angelman Syndrome/genetics*
;
China
;
DNA Copy Number Variations
;
Humans
;
Mutation
;
Pedigree
;
Phenotype
7.Electronic Cigarette or Vaping Product Use-Associated Lung Injury: A Case Report
Jiyun LIM ; Bo Da NAM ; Jung Hwa HWANG ; Yang-Ki KIM ; Eunsun OH ; Eun Ji LEE
Journal of the Korean Radiological Society 2021;82(6):1581-1588
Electronic cigarette (e-cigarette) or vaping product use-associated lung injury (EVALI) has emerged as a social issue as e-cigarette use is rapidly increasing worldwide and is related to many deaths in the United States. To our knowledge, this is the first case report of EVALI in South Korea of a 24-year-old man with acute respiratory symptoms and a history of e-cigarette use. Chest CT revealed diffuse bilateral ground-glass opacities with subpleural sparing, airspace consolidation, and centrilobular micronodules as typical patterns of EVALI with organizing pneumonia and diffuse alveolar damage. Infection was excluded with meticulous laboratory examinations, and the patients’ illnesses were not attributed to other causes. EVALI was diagnosed by meeting the diagnostic criteria with consistent clinico-radiologic findings through a multidisciplinary approach. Radiologists should have good knowledge of EVALI radiologic findings and play a cardinal role in the proper diagnosis and management of EVALI.
8.Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease.
Chinese Journal of Medical Genetics 2019;36(5):419-423
OBJECTIVE:
To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).
METHODS:
Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.
RESULTS:
Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.
CONCLUSION
Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis
;
Female
;
Humans
;
Mutation
;
Pedigree
;
Polycystic Kidney, Autosomal Dominant
;
Pregnancy
;
Prenatal Diagnosis
;
TRPP Cation Channels
9.Rare Mechanism of Acquired Resistance to Osimertinib in Korean Patients with EGFR-mutated Non-small Cell Lung Cancer.
Jiyun LEE ; Joon Ho SHIM ; Woong Yang PARK ; Hee Kyung KIM ; Jong Mu SUN ; Se Hoon LEE ; Jin Seok AHN ; Keunchil PARK ; Myung Ju AHN
Cancer Research and Treatment 2019;51(1):408-412
Epidermal growth factor receptor (EGFR)‒tyrosine kinase inhibitors (TKIs) are effective clinical therapeutics for EGFR-mutant non-small cell lung cancer (NSCLC). Osimertinib, a thirdgeneration EGFR TKI, has proven effective against T790M mutations. However, the vast majority of patients acquire resistance following successful treatment. A 59-year-old female patient with metastatic NSCLC developed resistance after 43 weeks of osimertinib. CancerSCAN of the metastatic liver lesion revealed a EGFR C797G mutation at an allele frequency of 72%, a preexisting T790M mutation (73%) in cis and an exon 19 deletion (87%). Another 53-year-old female patient developed systemic progression after 10 months of osimertinib. CancerSCAN of the lung biopsy identified an EGFR L718Q mutation at an allele frequency of 7%, concomitant PIK3CA E545K (12.90%) and preexisting EGFR L858R (38%), but loss of the T790M mutation. The heterogeneity of osimertinib resistance mechanisms warrants further investigation into novel or combination agents to overcome the rare acquired resistances.
Biopsy
;
Carcinoma, Non-Small-Cell Lung*
;
Exons
;
Female
;
Gene Frequency
;
Humans
;
Liver
;
Lung
;
Middle Aged
;
Phosphotransferases
;
Population Characteristics
;
Receptor, Epidermal Growth Factor
10.Simultaneous Determination of Isoquercitrin ,Astragalin and Salvianolic Acid B in Moringa oleifera Leaves Granules by HPLC
Haiyang YANG ; Yang LIU ; Mengwei LI ; Xueyan LI ; Jun HE ; Wenhong GU ; Jiyun YIN
China Pharmacy 2019;30(9):1164-1167
OBJECTIVE: To establish a method for simultaneous determination of isoquercitrin, astragalin and salvianolic acid B in Moringa oleifera leaves granules. METHODS: HPLC method was adopted. The determination was performed on Cosmosil-C18 column with mobile phase consisted of acetonitrile-0.1% phosphoric acid solution (gradient elution) at flow rate of 1.3 mL/min. The column temperature was 40 ℃ and detection wavelength was set at 260 nm. The sample size was 10 μL. RESULTS: The linear ranges of isoquercitrin, astragalin and salvianolic acid B were 0.017-0.341, 0.010-0.194, 0.010-0.195 mg/mL, respectively (all r>0.999 0). The detection limits were 0.085, 0.143, 0.117 μg/mL, and the limits of quantitation were 0.283, 0.476, 0.392 μg/mL, respectively. RSDs of precision, stability (24 h) and reproducibility tests were all lower than 2.0% (n=6). Average recoveries were 101.22%, 98.76% and 98.72%, and RSDs were 0.66%,0.30%,0.30% (n=6), respectively. CONCLUSIONS: The established method is simple, accurate and reproducible. It can be used for simultaneous determination of isoquercitrin, astragalin and salvianolic acid B in M. oleifera leaves granules.


Result Analysis
Print
Save
E-mail