Objective To investigate the influence of atorvastatin on tumor necrosis factor - α (TNF- α) of sepsis rats.Methods Sepsis models were established using male SD rats by cecal ligation and puncture (CLP).A total of 100 healthy rats were divided into 4 groups ( n =25) randomly ( random number):sham- operation group,CLP group,low- dose atorvastatin group and high -dose Atorvastatin group.Blood samples of 5 rats in each group were collected at postoperative 0,3,6,12 and 24 hours,to detect tumor necrosis factor - α (TNF - α) levels in plasma.Observe and compare the mobility of rats in each group and specimens of small intestine were taken for histopathological examination by optical microscope.Results At 0 hour,plasmic TNF - α levels in 4 groups were statistically equal (P ＞ 0.05 ).In plasma of sham - operation group,changes of TNF - α levels were not obvious.Compared with CLP group,TNF - α levels in low - dose and high - dose Atorvastatin groups were both significantly lower ( P ＜0.01 ) at postoperative 3,6,12 and 24 hours.And TNF-α levels in high -dose Atorvastatin group were significantly lower than those in low - dose group ( P ＜ 0.01 ) at the 4 time points.The mortality of sepsis was higher in CLP model group than other groups,That of Atorvastatin group was significantly lower than CLP model group but higher than control group and high - dose group was lower than low - dose group.Conclusions Atorvastatin can inhibit the expression of TNF - α in blood plasma of sepsis rats and reduce inflammatory reaction.

An ultra-high performance liquid chromatography-mass spectrometry ( UPLC-MS/MS) method was developed for the determination of 8 kinds of cephalosporins, cefoperazone, cefquinome, cefalonium, cefazolin, cefapirin, Ceftiofur, cefpirome and cefalexin, in edible parts of aquatic products. The samples were extracted with acetonitrile-water and cleaned up by multi-walled carbon nanotubes ( MwCNTs) SPE cartridge. All the target compounds were separated on an Acquity Xselect CSH C18 column with gradient elution by using acetonitrile and 0. 1% formic acid aqueous as eluent, and detected by UPLC-MS/MS under ESI+ ionization and MRM mode. Under optimized conditions, this method had a good linearity (R2≥0. 995) and the limits of quantification were in the range of 2-10 μg/kg ( S/N=10 ) . The recoveries of the method for the target compounds spiked at three different levels were 67. 3%-94. 2% with the relative standard deviations (RSDs) of 3. 3%-14%. The method had the characteristics of low cost, high accuracy and good precision, and could meet the requirements of cephalosporins determination.

Objective To study the effect of ratanasampil (RNSP) which is Traditional Tibetan Medicine on the levels of serum β-amyloid protein, interleukin and tumor necrosis factor alpha (TNF-α) in patients with mild to moderate Alzheimer's disease (AD). Methods One hundred AD patients were divided into two groups in randomized controlled study, including treatment group (RNSP 1 g/d) and control group (piracetam 2.4 g/d). The treatment lasted 12 weeks. The Mini Mental State Examination (MMSE), Alzheimer' s disease Assessment Scale-cognitive subscale (ADAS-cog) and Activity of Daily Living Scale (ADLs) were taken to evaluate the efficacy. Serum levels of amyloid peptides (Aβ40 and Aβ42 ) were measured by ELISA assay. The radioimmunologic assay was used to determine the serum levels of IL-1β, IL-2, IL-6, IL-8 and TNF-α. Results The scores of MMSE, ADAS-cog and ADL significantly improved at 12 weeks after RNSP treatment (P＜0.01, 0.01, 0.05, respectively), while had no significant changes in piracetam group (P＜0.05).The levels of TNF-α, IL-1β, IL-6 and Aβ42 were significantly lower in RNSP group than in Piracetam group (P＜0.01). There was a decrease trend of the Aβ42/Aβ40 ratio at 12 weeks after RNSP treatment (P＜0. 05, P＜0.01 ). The serum Aβ42 level had strong correlations with TNF-α, IL-1 β and IL-6. There were no significant differences in Aβ40 and IL-8 between RNSP group and piracetam group. No obvious drug side effect happened on the groups. Conclusions The reductions of serum TNF-α, IL-1β and IL-6 levels after RNSP treatment may lead to decrease of Aβ42 production in AD patients. RNSP may decrease the Aβ42/Aβ40 ratio and slow down the progress of AD. It may improve the learning and memory ability in treating patients with mild to moderate AD and is well tolerated and safe.

Aim To evaluate the short-term biocompatibility of a newkind of prosthetic nucleus-Evergel, which is made from the modifiedpolyvinyl alcohol hydrogel. Methods According to China national standardGB/T16886 documents, the toxicity of Evergel prosthetic nucleus materialwas investigated by the cytotoxicity test, sensitization test, haemolysis test,Ames test, mice marrow micronucleus test and chromosome aberration test ofmammalian cell in vitro. Results This material had no cytoxicity, no sen-sitivity, no obvious haemolysis, and no mutagencity in Ames test, micemarrow micronucleus test and chromosome aberration test of mammalian cellin vitro. Conclusion The Evergel prosthetic nucleus has a good biocom-patibility and can be used clinically.

Objective:To study the signal enhancement of lung adenocarcinoma nude mice after injection of immunomagnetic bead solution (magnetic beads conjugated with monoclonal antibody NJ001) in micro-CT scan. Methods:The models of lung adenocarcino-ma nude mice were established by injecting SPC-A1-luc cells through the tail vein and were validated by bioluminescence imaging (BLI). The nude mice were divided into three groups: physiological saline group, bare magnetic bead group, and immunomagnetic bead group. Three groups of nude mice were injected with physiological saline, 750 nm bare magnetic bead solution, and immuno-magnetic bead solution via the tail vein every week, and micro-CT scan was taken before and 4 h after injection. Immunohistochemis-try (IHC) was used to detect the expression of antigen SP70 in tumor tissues. Results:The tumor was detected in the immunomagnetic bead group at the fourth week, whereas in the physiological saline and bare magnetic bead groups, the tumor was undetectable until the sixth week. The tumor intensities detected at the sixth week by micro-CT scan in the physiological saline, bare magnetic bead, and immunomagnetic bead groups were 59.05 ± 0.66, 60.69 ± 0.55, and 58.25 ± 0.32 before injection and 60.30 ± 1.83, 61.05 ± 0.68, and 67.41±3.82 after injection, respectively. Compared with the tumor intensities before injection, they significantly increased after injec-tion in the immunomagnetic bead group;the difference was statistically significant (P=0.0079). By contrast, no statistical significance was observed in the tumor intensities before and after injection in the physiological saline and bare magnetic bead groups (P=0.1867 and P=0.3839, respectively). Conclusion:The immunomagnetic beads had enhanced effect on micro-CT scan of lung adenocarcinoma nude mouse models.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.