1.Effects of atorvastatin on levels of TNF-α in septic rats
Zhiyu WANHG ; Jian YU ; Jingping GU ; Maoxing QU ; Huiyi LU
Chinese Journal of Emergency Medicine 2011;20(10):1047-1051
Objective To investigate the influence of atorvastatin on tumor necrosis factor - α (TNF- α) of sepsis rats.Methods Sepsis models were established using male SD rats by cecal ligation and puncture (CLP).A total of 100 healthy rats were divided into 4 groups ( n =25) randomly ( random number):sham- operation group,CLP group,low- dose atorvastatin group and high -dose Atorvastatin group.Blood samples of 5 rats in each group were collected at postoperative 0,3,6,12 and 24 hours,to detect tumor necrosis factor - α (TNF - α) levels in plasma.Observe and compare the mobility of rats in each group and specimens of small intestine were taken for histopathological examination by optical microscope.Results At 0 hour,plasmic TNF - α levels in 4 groups were statistically equal (P > 0.05 ).In plasma of sham - operation group,changes of TNF - α levels were not obvious.Compared with CLP group,TNF - α levels in low - dose and high - dose Atorvastatin groups were both significantly lower ( P <0.01 ) at postoperative 3,6,12 and 24 hours.And TNF-α levels in high -dose Atorvastatin group were significantly lower than those in low - dose group ( P < 0.01 ) at the 4 time points.The mortality of sepsis was higher in CLP model group than other groups,That of Atorvastatin group was significantly lower than CLP model group but higher than control group and high - dose group was lower than low - dose group.Conclusions Atorvastatin can inhibit the expression of TNF - α in blood plasma of sepsis rats and reduce inflammatory reaction.
2.Effect of Tibet-medicine Ratanasampil on serum β-amyloid protein and inflamatory cytokine levels in patients with Alzheimer's disease
Aiqin ZHU ; Yide CHU ; Guofeng LI ; Baoxia LIAO ; Xin ZHONG ; Jingping ZHOU ; Songqin GU ; Meihua YU
Chinese Journal of Geriatrics 2011;30(2):133-137
Objective To study the effect of ratanasampil (RNSP) which is Traditional Tibetan Medicine on the levels of serum β-amyloid protein, interleukin and tumor necrosis factor alpha (TNF-α) in patients with mild to moderate Alzheimer's disease (AD). Methods One hundred AD patients were divided into two groups in randomized controlled study, including treatment group (RNSP 1 g/d) and control group (piracetam 2.4 g/d). The treatment lasted 12 weeks. The Mini Mental State Examination (MMSE), Alzheimer' s disease Assessment Scale-cognitive subscale (ADAS-cog) and Activity of Daily Living Scale (ADLs) were taken to evaluate the efficacy. Serum levels of amyloid peptides (Aβ40 and Aβ42 ) were measured by ELISA assay. The radioimmunologic assay was used to determine the serum levels of IL-1β, IL-2, IL-6, IL-8 and TNF-α. Results The scores of MMSE, ADAS-cog and ADL significantly improved at 12 weeks after RNSP treatment (P<0.01, 0.01, 0.05, respectively), while had no significant changes in piracetam group (P<0.05).The levels of TNF-α, IL-1β, IL-6 and Aβ42 were significantly lower in RNSP group than in Piracetam group (P<0.01). There was a decrease trend of the Aβ42/Aβ40 ratio at 12 weeks after RNSP treatment (P<0. 05, P<0.01 ). The serum Aβ42 level had strong correlations with TNF-α, IL-1 β and IL-6. There were no significant differences in Aβ40 and IL-8 between RNSP group and piracetam group. No obvious drug side effect happened on the groups. Conclusions The reductions of serum TNF-α, IL-1β and IL-6 levels after RNSP treatment may lead to decrease of Aβ42 production in AD patients. RNSP may decrease the Aβ42/Aβ40 ratio and slow down the progress of AD. It may improve the learning and memory ability in treating patients with mild to moderate AD and is well tolerated and safe.
3.Determination of 8 Kinds of Cephalosporins in Aquatic Products by Multi-walled Carbon Nanotubes Solid Phase Extraction-Ultra High Performance Liquid Chromatography-Mass Spectrometry
Beiqiao GU ; Guangming MEI ; Xiaojun ZHANG ; Yina HE ; Zhongyong YAN ; Jingping ZHU
Chinese Journal of Analytical Chemistry 2017;45(3):381-388
An ultra-high performance liquid chromatography-mass spectrometry ( UPLC-MS/MS) method was developed for the determination of 8 kinds of cephalosporins, cefoperazone, cefquinome, cefalonium, cefazolin, cefapirin, Ceftiofur, cefpirome and cefalexin, in edible parts of aquatic products. The samples were extracted with acetonitrile-water and cleaned up by multi-walled carbon nanotubes ( MwCNTs) SPE cartridge. All the target compounds were separated on an Acquity Xselect CSH C18 column with gradient elution by using acetonitrile and 0. 1% formic acid aqueous as eluent, and detected by UPLC-MS/MS under ESI+ ionization and MRM mode. Under optimized conditions, this method had a good linearity (R2≥0. 995) and the limits of quantification were in the range of 2-10 μg/kg ( S/N=10 ) . The recoveries of the method for the target compounds spiked at three different levels were 67. 3%-94. 2% with the relative standard deviations (RSDs) of 3. 3%-14%. The method had the characteristics of low cost, high accuracy and good precision, and could meet the requirements of cephalosporins determination.
4.Evaluation of the short-term biocompatibility of a new kind of hydrogel prosthetic nucleus
Jingping WU ; Tongyi CHEN ; Zhongwei CHEN ; Zhewei HUANG ; Guozhen GU ; Hua LU ; Aiying MENG ; Yunfang QIAN ; Yagu LI
Chinese Journal of Tissue Engineering Research 2003;7(20):2778-2780
Aim To evaluate the short-term biocompatibility of a newkind of prosthetic nucleus-Evergel, which is made from the modifiedpolyvinyl alcohol hydrogel. Methods According to China national standardGB/T16886 documents, the toxicity of Evergel prosthetic nucleus materialwas investigated by the cytotoxicity test, sensitization test, haemolysis test,Ames test, mice marrow micronucleus test and chromosome aberration test ofmammalian cell in vitro. Results This material had no cytoxicity, no sen-sitivity, no obvious haemolysis, and no mutagencity in Ames test, micemarrow micronucleus test and chromosome aberration test of mammalian cellin vitro. Conclusion The Evergel prosthetic nucleus has a good biocom-patibility and can be used clinically.
5.Enhanced effect of immunomagnetic beads on micro-CT scan of the lung adenocarci-noma mouse model
Yue WANG ; Shiyang PAN ; Juanjuan ZHU ; Ting XU ; Jian XU ; Jingping LIU ; Fang WANG ; Chunrong GU ; Lixia ZHANG
Chinese Journal of Clinical Oncology 2017;44(12):583-588
Objective:To study the signal enhancement of lung adenocarcinoma nude mice after injection of immunomagnetic bead solution (magnetic beads conjugated with monoclonal antibody NJ001) in micro-CT scan. Methods:The models of lung adenocarcino-ma nude mice were established by injecting SPC-A1-luc cells through the tail vein and were validated by bioluminescence imaging (BLI). The nude mice were divided into three groups: physiological saline group, bare magnetic bead group, and immunomagnetic bead group. Three groups of nude mice were injected with physiological saline, 750 nm bare magnetic bead solution, and immuno-magnetic bead solution via the tail vein every week, and micro-CT scan was taken before and 4 h after injection. Immunohistochemis-try (IHC) was used to detect the expression of antigen SP70 in tumor tissues. Results:The tumor was detected in the immunomagnetic bead group at the fourth week, whereas in the physiological saline and bare magnetic bead groups, the tumor was undetectable until the sixth week. The tumor intensities detected at the sixth week by micro-CT scan in the physiological saline, bare magnetic bead, and immunomagnetic bead groups were 59.05 ± 0.66, 60.69 ± 0.55, and 58.25 ± 0.32 before injection and 60.30 ± 1.83, 61.05 ± 0.68, and 67.41±3.82 after injection, respectively. Compared with the tumor intensities before injection, they significantly increased after injec-tion in the immunomagnetic bead group;the difference was statistically significant (P=0.0079). By contrast, no statistical significance was observed in the tumor intensities before and after injection in the physiological saline and bare magnetic bead groups (P=0.1867 and P=0.3839, respectively). Conclusion:The immunomagnetic beads had enhanced effect on micro-CT scan of lung adenocarcinoma nude mouse models.
6.Analysis on occupational health monitoring to workers in Zhoushan City
Danyan FAN ; Yuan WU ; Zhongchao GU ; Jingping YI
Chinese Journal of Industrial Hygiene and Occupational Diseases 2020;38(12):944-947
Objective:To analyze the occupational health monitoring data of workers in Zhoushan City, and provide scientific basis for health monitoring and the formulation of occupational disease prevention measures.Methods:From January 2016 to November 2019, the occupational health examination data of 37826 workers in Zhoushan City were collected to analyze the change trend of the detection rate of suspected occupational diseases and occupational contraindications, and to compare the health monitoring status of workers with different social characteristics such as enterprise scale and economic type.Results:From 2016 to 2019, the detection rate of suspected occupational diseases showed a downward trend (χ 2trend=21.09, P<0.05) . The occupational health examination of on-the-job workers in Zhoushan were mainly small enterprises (59.72%, 22591/37826) , private economic enterprises (65.32%, 24707/37826) , male (82.03%, 31028/37826) , 30-49 years old (59.11%, 22359/37826) , and exposed to noise (67.06%, 25365/37826) . The detection rates of occupational contraindications and suspected occupational diseases were higher in micro enterprise, male, over 60 years old, exposed to occupational hazards for more than 49 months, and exposed to chemical and physical hazards at the same time. The detection rates of occupational contraindications and suspected occupational diseases were significantly different among different enterprise scale, economic type, gender, age and occupational hazard factors ( P<0.05) . Among benzene workers with occupational contraindications and suspected occupational diseases, the detection rate of A/G abnormality in female workers was higher than that in male workers ( P=0.04) , and there was no significant difference in other genders ( P>0.05) . Conclusion:It is necessary to pay more attention to the workers working in small and private enterprises in Zhoushan City, strengthen the occupational health supervision of male workers who are over 60 years old who are exposed to benzene, noise and other occupational hazards, standardize the occupational health inspection, and effectively protect the health of the occupational population.
7.Analysis on occupational health monitoring to workers in Zhoushan City
Danyan FAN ; Yuan WU ; Zhongchao GU ; Jingping YI
Chinese Journal of Industrial Hygiene and Occupational Diseases 2020;38(12):944-947
Objective:To analyze the occupational health monitoring data of workers in Zhoushan City, and provide scientific basis for health monitoring and the formulation of occupational disease prevention measures.Methods:From January 2016 to November 2019, the occupational health examination data of 37826 workers in Zhoushan City were collected to analyze the change trend of the detection rate of suspected occupational diseases and occupational contraindications, and to compare the health monitoring status of workers with different social characteristics such as enterprise scale and economic type.Results:From 2016 to 2019, the detection rate of suspected occupational diseases showed a downward trend (χ 2trend=21.09, P<0.05) . The occupational health examination of on-the-job workers in Zhoushan were mainly small enterprises (59.72%, 22591/37826) , private economic enterprises (65.32%, 24707/37826) , male (82.03%, 31028/37826) , 30-49 years old (59.11%, 22359/37826) , and exposed to noise (67.06%, 25365/37826) . The detection rates of occupational contraindications and suspected occupational diseases were higher in micro enterprise, male, over 60 years old, exposed to occupational hazards for more than 49 months, and exposed to chemical and physical hazards at the same time. The detection rates of occupational contraindications and suspected occupational diseases were significantly different among different enterprise scale, economic type, gender, age and occupational hazard factors ( P<0.05) . Among benzene workers with occupational contraindications and suspected occupational diseases, the detection rate of A/G abnormality in female workers was higher than that in male workers ( P=0.04) , and there was no significant difference in other genders ( P>0.05) . Conclusion:It is necessary to pay more attention to the workers working in small and private enterprises in Zhoushan City, strengthen the occupational health supervision of male workers who are over 60 years old who are exposed to benzene, noise and other occupational hazards, standardize the occupational health inspection, and effectively protect the health of the occupational population.
8.Comparison of application effects of three downstream thrombolysis through superficial dorsal pedal veins in the treatment of deep venous thrombosis of lower extremity
Yan LI ; Jingping GE ; Yuanyuan YIN ; Jianping GU
Chinese Journal of Modern Nursing 2020;26(26):3629-3633
Objective:To compare the application effects and comfort of three downstream thrombolysis through superficial dorsal pedal veins in the treatment of deep venous thrombosis (DVT) of lower extremity.Methods:From January 2014 to October 2018, data of 120 patients with DVT who treated in Nanjing First Hospital of Nanjing Medical University were retrospectively analyzed. They were divided into the non-intervention group (the control group) , silicone tourniquet group (the experimental group I) and limb pressure band group (the experimental groupⅡ) , with 40 cases in every group. The daily thrombolytic drugs were the same in the three groups. No other intervention was carried out in the control group. In the experimental groupⅠ, a tourniquet was ligated 15 cm above the osseous mark of the medial malleolus of the affected limbs, the superficial vein blood flow was completely blocked by the lower limb venography, and the blood flow in the deep vein was fully developed. In the experimental group Ⅱ, limb pressure bands were used 15 cm above the osseous mark of the medial malleolus of the affected limb, DSA angiography was used to determine the optimal airbag inflation pressure value when the superficial vein was completely blocked, and the deep vein was fully developed. For the two experimental groups, ligation (tourniquet) or inflation (limb pressure band) at the same site was performed for 15 min, and relaxation time was 15 min, alternately without interruption. The detumescence rate of affected limb, clearance rate of thrombosis and comfort of affected limb were compared among the 3 groups.Results:In experimental group Ⅱ, the detumescence rate of affected limb was (83.40±8.91) % and the venous patency was (86.25±20.61) %, which were better than those of the control group and the experimental group I, and the differences were statistically significant ( F=3.767, 4.675; P<0.05) . 10 days after treatment, the clearance rate of thrombosis of the experimental groupⅡ, the control group and the experimental group I were respectively (96.50±2.78) %, (83.38±3.77) % and (87.13±2.71) %. The differences among the three groups were statistically significant ( F=13.019, P<0.01) . The limb comfort of the experimental groupⅡ was 87.5% (35/40) , and that of the experimental group I was 20.0% (8/40) , and the difference was statistically significant (χ 2=36.656, P<0.01) . Conclusions:In the downstream thrombolytic treatment of lower limb DVT through dorsal pedal veins, the use of a timed, constant pressure limb pressure band to block the superficial vein blood flow can achieve better thrombolytic curative effects and higher comfort degree of patients
9.Influence of extended nursing care on postoperative quality of life of patients undergoing coronary artery bypass grafting
Ping WANG ; Xiaoqin PEI ; Qin YIN ; Xiaolin XU ; Jingping GU
Chinese Journal of Modern Nursing 2017;23(4):497-501
Objective To explore the influence of extended nursing care on postoperative quality of life (QOL) of patients undergoing coronary artery bypass grafting (CABG).Methods By convenience sampling method,86 inpatients with coronary heart disease (CHD),receiving CABG from January 2009 to July 2015 in department of cardiothoracic surgery of Yancheng Hospital Affiliated to School of Medicine,Southeast University,were selected and divided into the control group (n=43) and the experimental group (n=43) according to random number table method. Patients in the control group were cared by routine nursing,and were instructed at discharge about precautions,time of medicine taking and re-examination;while patients in the experimental group were cared by extended nursing according to previously designed health-management plan. Scores of QOL at discharge,one month after discharge and three months after discharge,incidence of abnormal blood pressure,blood glucose and blood lipid of patients between two groups were compared.Results There was no significant difference in the scores of QOL,incidence of abnormal blood pressure,blood glucose and blood lipid of patients between two groups at discharge and 1 month after discharge (P>0.05). Three months after discharge,scores of QOL of patients in the experimental group were significantly higher than those in the control group,while incidence of abnormal blood pressure,blood glucose and blood lipid is lower in the experimental group than those in the control group (P<0.05).Conclusions Extended nursing care for patients after CABG can stimulate their initiative in participating in self health management,and improve their QOL,which make it worth promoting.
10.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.