Objective:To seek better treatments for abnormal pelvic floor muscle tension and pelvic floor dysfunction after spinal cord injury.Methods:The morphology of pelvic floor muscle fibers of rats with spinal cord injury at different levels was observed under the electron microscope. Thirty female adult Sprague-Dawley rats were randomly divided into a suprasacral (SS) cord injury group, a group with spinal cord injury at or below the sacral level (SC) and a normal group (NG), each of 10. The relevant spinal cord injury models were established in the SS and SC groups through spinal cord disconnection. Four weeks later, the pixel area of ATPase-positive fibers was used to quantify the content of type I fibers in the pubococcygeus muscle of each rat through observation under the electron microscope after hematoxylin and eosin staining.Results:The average content of type I muscle fibers in both the SS and SC group was significantly lower than in the normal group. The SC group′s average level was significantly lower than that of the SS group. Under the microscope the stained myofibers were tortuous, deformed in appearance and with proliferated nuclei. Capillary dilation could be seen locally in the SS group 4 weeks after the injury. In the SC group at 4 weeks after the injury the pubococcal fibers were seriously "dissolved" , or disordered, with spherical nuclei and mild hyperplasia. Under the electron microscope, the sarcomeres of the SC group were obviously dissolved, atrophied and broken, though the basic structure persisted, with mild mitochondrial proliferation. The sarcomeres of the SC group were extremely dissolved and broken, completely losing basic structure, with abundant connective tissue proliferation but without obvious mitochondrial proliferation.Conclusions:After suprasacral cord injury, the content of type I muscle fibers in the pubococcygeus muscle of the pelvic floor decreases somewhat, with the basic structure of the muscle fibers remaining intact. However, after spinal cord injury at or below the sacral level, type I muscle fibers decrease significantly in the pubococcygeus muscle of the pelvic floor, and the basic structure is seriously damaged.

Objective To compare the effects of aspirin and clopidogrel on platelet aggregation function by TEG,and to study the antiplatelet agents tailored therapy of Thrombelastography(TEG)in treatment of cerebral infarc-tion patients.Methods 100 patients with acute cerebral infarction were included in two groups:aspirin group and clopidogrel group.The inhibitory rates of AA and ADP receptor pathway in platelets were detected by TEG.The effect of inhibitory rates in group aspirin and clopidogrel was compared with nerve function and the recurrence rate of stroke. Results The inhibitory rates of group aspirin (85.23 ±21.98)% was higher than group clopidogrel (47.31 ± 22.37)% (t =7.340,P =0.005).The patients with which the inhibitory rates showed goodby TEG in group aspirin and clopidogrel got better neurological recovery,and the patients showed goodby TEG in group aspirin got lower stroke recurrence rate within 1 year(χ2 =4.460,P =0.035;χ2 =7.232,P =0.007).Conclusion TEG had guided the antiplatelet individual therapy for cerebral infarction patients,and can be used to predict and confirm the efficacy of antiplatelet drug.

Appendiceal mucinous adenocarcinoma is a rare disease.The preoperative diagnosis is almostly impossible due to the lack of typical symptoms and inexperienced surgeons.One patient with appendiceal mucinous adenocarcinoma was diagnosed successfully at the 210th Hospital of Chinese PLA,who was misdiagnosed as with periappendiceal abscess by other hospitals.The result of intraoperative frozen pathological section confirmed appendiceal mucinous adenocarcinoma.And then the patient received extended resection and effective recovery.

Objective To propose a remote printing mode for hospital clinical report to enhance the efficiency of clinical staffs.Methods A function module for report export was developed based on scheme demonstration,and the obstacles between internal and external networks were eliminated.Results The mode had the clinical requirements satisfied,medical errors avoided and medical cost saved.Conclusion The mode can be implemented in some hospital with multi sections and ununified information systems,and thus has practical values.

Objective To evaluate the application value of combination of low kV,low mAs,and iterative model reconstruction (IMR) in carotid CT angiography.Methods Forty patients (BMI 20-25 kg/m2) were enrolled and randomly divided into routine dose group(20) and low dose group(20),The parameters in routine dose group were 120 kV,automatic mAs,and filter back projection(FBP);and that in low dose group were 80 kV,automatic mAs but upper limit 150 mAs,and FBP or IMR.All patients received the injection of 32 ml of iopamidol(370 mg I/100 ml) at a flow rate of 4 ml/s,followed by 50 ml normal saline at the same rate.The CT value and image noise(SD)of the aortic arch,left carotid artery bifurcation,and right carotid artery of rock bone were measured with region of interest(ROI) method,and then signal to noise ratios (SNR) and contrast to noise ratio (CNR)of image were calculated.The image quality was evaluated by two radiologists using a subjective four points scale on multiplanar reformated (MPR),maximum density projected (MIP) and volume rendered (VR) images.Volume CT dose index (CTDIvol),dose length product (DLP),and the effective dose (E) of each patient were recorded.Results CT values of carotid artery[(479.87 ± 70.28),(514.78 ± 82.69),(436.50 ± 89.87) HU] in low dose group were significantly higher than those in routine dose group [(295.63 ± 34.75),(325.09 ± 37.81),(286.93±36.46)HU](t =-6.47,-5.76,-3.66,P＜0.05).The SNR and CNR of IMR reconstructed image in low dose group were significantly higher than those of FBP reconstructed image in routine dose group (t =-7.54,-3.55,-5.31,-7.13,-5.28,-8.35,P＜0.05).The image quality of FBP reconstructed images in routine dose group and IMR reconstructed images in low dose group were all enough for diagnosis.The image quality of FBP reconstructed images in low dose group was significantly poorer than that in routine dose group and IMR reconstructed images in low dose group (Z =-2.87,-3.69,P ＜0.05).The effective dose in low dose group (0.57 ±0.13) mSv was 73％ less than that in routine dose group (2.22 ± 0.36) mSv.Conclusions Using low kV,low mAs,and IMR would help to obtain good carotid CT angiographic images and low radiation dose.

Objective To investigate the feasibility and safety of transcatheter closure of coronary artery fistula (CAF)with Amplatzer vascular PlugⅡ(AVPⅡ)in pediatric patients.Methods Between June 2012 and October 2015,5 children aged 0.9 to 7.0 years old and weighted 10 to 21 kg with CAF were admitted to the Department of Pediatric Cardiology in Shandong Provincial Hospital Affiliated to Shandong University.Aortic root angiography was used first to confirm the origin,shape,branches,drainage and the diameter of the orifice of CAF by deploying the pigtail catheter.The AVPⅡwas retrogradely deployed into targeted artery through guiding catheter and aortic angiography was performed before releasing the plug.Results All the 5 children underwent transcatheter closure by AVPⅡsuccessful-ly.Two cases were involved with right coronary -right ventricular fistula,1 case of left anterior descending coronary -right ventricular fistula (residual fistula after surgical repair),and 1 case of left circumflex coronary -left atrial fistula. Four children had a single fistula,and 1 case had double fistulas.The diameter of the orifice ranged from 2.00 to 5.96 mm,and the selected occluders from 8 to 14 mm.The ratio of diameter of occluder to fistula orifice ranged from 2.3 to 3.4.All the patients were followed up for 4 to 44 months.Two patients developed instant minor and modera-te aortic re-gurgitation.No other complications such as thrombosis,embolization,residual shunt,arrhythmia,coronary dissection or perforation occurred.Conclusions Transcatheter closure of CAF by AVPⅡin pediatric patients is feasible and safe. Aortic regurgitation should be noted,especially during the procedure.

Objective To apply DNA barcoding technology for exploring its taxonomic status and differences in the molecular biology of Cricetulus barabensis in Shaanxi Province.Methods Sixty-five samples of Cricetulus barabensis were collected from Dingbian,Jingbian Counties in northern of Shaanxi and Dali County in Guanzhong plain (Dingbian 58 samples,Jingbian 2 samples,and Dali 5 samples).According to the mitochondrial cytochrome C oxidase subunit I gene (CO I) sequence,the genetic distance was calculated and Neighbor-Joining tree was constructed.Results The genetic distance between two samples (13.16,13.21) and other 56 samples of Dingbian was 9.2％-10.0％.The genetic distance between the 56 samples of Dingbian and Jingbian was less than 1％ and Dali was 7.2％-8.3％;the average intraspecific genetic distance of Jingbian and Dali was less than 1％.The Neighbor-Joining tree showed that all the Cricetulus barabensis samples from the three counties were separated into two large branches.The samples of 13.16,13.21 from Dingbian together were classified into a class and the rest of the samples into another separate branch.At the same time,other samples from Dingbian except 13.16,13.21 and Jingbian were distributed in a small branch,and Dali samples were occupied another small branch.Conclusion Using the DNA barcoding technology,we have determined three subspecies of Cricetulus barabensis in Shaanxi Province,Dingbian has two kinds and Dali has a different subspecies.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To explore the effect of chitosan on vascular smooth muscle cells inhibited proliferation from rabbit arteriovenous fistula and its mechanisms.Methods Established rabbit fistula model on carotid arteryinternal jugular vein.After 1 month cultured VSMCs with primary culture by tissue-pieces inoculation.Cultured VSMCs were divided into three groups:①normal control group.②FBS-treated group:cell were treated with 5％,10％,20％ for 48 h,respectively; established the model of rabbit VSMCs proliferation.③chitosan-treated group:VSMCs cultured with 20％ FBS were exposed to different doses of chitosan(10,100,500,1000,2000μg/ml) for 48 h.And VSMCs were treated for different time (0,12,24,48 h) with Chitosan 1000 μg/ml.Expression levels of PCNA and TLR4/ NF-κB were detected by Western blotting.RT-PCR were applied to measure the mRNA expression of PCNA and TLR4.The protein levels of TLR4 and NF-κB were detected by immunofluorescence.Results Compared with low concentration serum group,FBS-treated VSMCs exhibited a increase in mRNA and protein expression of PCNA and TLR4.FBS-induced protein expression of PCNA and TLR4/NF-κB were reduced by chitosan.Also mRNA expression of PCNA and TLR4 were reduced.They were dependent on concentration and time.In rabbit VSMCs TLR4 was mainly expressed in the cytoplasm and NF-κB expressed mainly in the nucleus.Compared with normal control group,TLR4 and NF-κB protein expression were significantly decreased by chitosan.Conclusion High concentration serum induced VSMCs proliferation.Chitosan can inhibit the proliferation of rabbit VSMCs.It is speculated that the mechanism may be related to the expression of TLR4 receptor activation,reducing expression of downstream factor MyD88 and NF-κB.It is suggest that chitosan can become potential new drugs of arteriovenous fistula prevention of intimal hyperplasia.

Objective To investigate the voiding patterns of term and preterm newborns and whether voiding in term and preterm neonates was accompanied by any cortical arousal. Methods Between May 2013 and September 2013,64 hospitalized newborns at Neonatal Intensive Cave Unit in the Frist Affiliated Hospital of Zhengzhou University were recruited in this study. In these patients,31 cases were term newborns(20 male,11 female)and 33 cases were preterm newborns(19 male,14 female). The term and preterm newborns gestational ages at birth were(38. 2 ± 1. 2) weeks and(32. 1 ± 1. 6)weeks,weighted(3. 3 ± 0. 4)kg and(1. 7 ± 0. 3)kg,respectively and postnatal ages at study were[4 - 16(10. 5 ± 3. 6)]days and[4 - 16(11. 2 ± 3. 1)]days. The voiding volume(VV),post - void residual volumes(PRV),body movement rate and voiding frequency(VF)in 4 hours as well as the volume of milk and liquid fed at the same time frame were recorded and analyzed,retrospectively. At the same time electrocardiogram(ECG)and electroencephalogram(EEG)were recorded. The changes of heart rate(HR),EEG frequency,respiratory frequency (RF)during the 5 s period and 30 s before and after voiding onset were compared respectively. For cortical arousal definition the recommendations of the International Pediatric Work Group on Arousals(2005)were used. Results A total of 184 times of voiding were recorded. In preterm newborns,the VV and body movements rate were significantly lower compared with the term newborns[(21. 8 ± 7. 9)mL and(41 ± 21)% vs(26. 4 ± 8. 7)mL and(62 ± 19)% , t = 3. 75,4. 20,all P ﹤ 0. 05]. However,the VF and PRV were significantly higher in preterm newborns[(1. 7 ± 0. 9) mL and(3. 2 ± 1. 1)times vs(1. 2 ± 0. 7)mL and(2. 6 ± 0. 9)times,t = 2. 47,2. 38,all P ﹤ 0. 05]. Bladder voiding in these infants happened only during QS. In term newborns,HR frequency was higher during the 5 s interval before and after voiding onset when compared with the 30 s period before voiding onset[(152 ± 6)times/ min and(152 ± 5) times/ min vs(147 ± 6)times/ min,t = 5. 30,5. 76,all P ﹤ 0. 05]and the EEG frequency[(2. 6 ± 0. 1)Hz and (2. 6 ± 0. 1)Hz vs(1. 5 ± 0. 1)Hz,t = 70. 0,70. 0,all P ﹤ 0. 05]. While the HR and EEG frequency of preterm neo-nate was not changed before and after bladder voiding onset. The RF of both term and preterm neonates were not changed before and after bladder voiding onset. Conclusions The voiding patterns between term and preterm were sig-nificantly different and cortical arousal was found only in term neonates,which indicate the term newborns have better mature bladder function and development of nervous system.