1.Analysis of hospital-acquired conditions using the CHADx model
Jianjun JIAO ; Ying HUO ; Yanyan WANG
Chinese Journal of Hospital Administration 2016;32(2):111-114
Hospital-acquired conditions (HACs)are key to patient safety.This paper introduced a new classification system of HACs,the CHADx model,and described the principle and method of establishing the model as well as the problems found during its use.The model can provide a basis for studying the problem of incidence,causes and influence factors of hospital acquired conditions,so as to help medical institutions to explore the causes of HACs and to ensure patient safety and improve the quality of health care.
2.Isolation of Carbapenems-resistant Gram-negative Bacillus and Analysis of Producing Metallo-β-lactamase
Guangmin ZHENG ; Fei PANG ; Wei LI ; Jianmin HUO ; Jianjun YANG
China Pharmacy 2017;28(11):1482-1485
OBJECTIVE:To provide reference for rational use of antibiotics in the clinic of our hospital. METHODS:Drug re-sistance of Gram-negative bacillus in the inpatients of our hospital were analyzed retrospectively during May 2013-Dec. 2015 as well as the situation of producing metallo-β-lactamase(MBLs). RESTUTS:A total of 2089 strains of Gram-negative bacillus were detected in our hospital during 2013-2015,among which there were 1456 strains of enterobacteria (69.70%) and 633 strains of non-fermentative bacteria,mainly involving Escherichia coli,Pseudomonas aeruginosa,Klebsiella pneumoniae,Acinetobacter bau-mannii and Enterobacter cloacae. A total of 406 strains of carbapenems-resistant bacteria were detected (19.44%),including 367 strains of non-fermentative bacteria and 39 strains of enterobacteria. The resistant rates of carbapenems-resistant strains to 16 antibi-otics were all higher than 50%,but those of non-carbapenems-resistant strains were in relative low level. Except for aztreonam,re-sistant rates of carbapenems-resistant strains to other 15 antbiotics were all higher than those of non-carbapenems-resistant strains, with statistical significance(P<0.05). A total of 36 strains of producing MBLs were detected(8.87%),including 13 strains of pro-ducing MBLs drug-resistant P. aeruginosa and 23 strains of producing MBLs drug-resistant A. baumannii;producing MBLs drug re-sistant enterobacteria had not been found. CONCLUSIONS:Gram-negative bacillus are mainly enterobacteria in our hospital;car-bapenems-resistant strains are mainly non-fermentative bacteria,resistant rate of them are commonly higher than that of non-drug-re-sistant strain. The situation of producing MBLs is serious,and enzyme producing strains are mainly non-fermentative bacteria. It is necessary to strengthen drug resistance of pathogen and enzyme producing strain monitoring,avoid the generation and spreading of drug-resistant strains due to irrational use of antibiotics.
3.Influence of perioperative antibiotics use on incision healing of simple upper limb closed fracture
Wei ZHAO ; Jianjun CHANG ; Qiang LI ; Jianzhong HUO
Chinese Journal of Trauma 2015;31(3):207-211
Objective To respectively investigate the impact of perioperative use of antibiotics on incision healing of simple upper limb closed fracture.Methods The study enrolled 124 patients with simple upper limb closed fracture treated from October 2012 to June 2013,including fracture of humerus (surgical neck,shaft,and supracondyla),fracture of forearm (ulna,olecranon,and radius)and fracture of metacarpus.The patients were allocated to non-antibiotic group (n =73) and antibiotictreated group (n =51) according to the random number table.Between-group analysis was made on body temperature,peripheral white blood cell count,C-reactive protein level,drainage fluid culture and incision healing.Results Sex,age,disease entity and operation time were similar between the two groups (P > 0.05).Non-antibiotic and antibiotic-treated groups showed no significant differences in body temperature [preoperation:(36.50 ± 0.27) ℃ vs (36.70 ± 0.39) ℃ ; postoperation:(37.64 ± 0.37) ℃vs (37.41 ±0.41)℃],peripheral white blood cell count [preoperation:(6.1 ±1.0) × 109 mol/L vs (6.5 ±0.8) × 109 mol/L; postoperation:(12.1 ±0.7) × 109 mol/L vs (11.3 ±0.6) × 109mol/L] and C-reactive protein level [preoperation:(7.2 ±0.9)mg/L vs (6.7 ±0.7)mg/L; postoperation:(12.0 ± 1.3) mg/L vs (13.4 ±0.9)mg/L] (P >0.05).Incisional infection occurred in 1 case (1%) in non-antibiotic group,but none in antibiotic-treated group (P > 0.05).Conclusions For simple upper limb closed fracture,perioperative use of antibiotic has advantages of slight trauma,short operation time and few bleeding.Likewise,satisfactory bone healing is achieved in the absence of antibiotics during perioperative period.
4.Clinical Observation of Ebastine Combined with Chushi Zhiyang Ointment in the Treatment of Hand Keratin-izing Chapped Eczema
Ying ZHENG ; Jianjun REN ; Weihong HUO ; Juan LIANG ; Zhe ZHOU
China Pharmacy 2016;27(26):3697-3699
OBJECTIVE:To observe clinical efficacy and safety of Ebastine tablet combined with Chushi zhiyang ointment in the treatment of hand keratinizing chapped eczema. METHODS:135 cases of hand keratinizing chapped eczema were divided into control group A(45 cases),control group B(43 cases)and treatment group(47 cases)according to treatment regimen. Control group A was orally given Ebastine tablet,10 mg each time,qd;control group B was given Chushi zhiyang ointment alone,twice a day,morning and evening,applying thin layer of ointment on the affected area;treatment group was given same dose of Ebastine tablet orally and applied Chushi zhiyang ointment on the affected area. 3 groups received treatment for consecutive 4 weeks. Clinical efficacies of 3 groups were observed as well as the scores of pruritus,skin lesion area,keratinization,rhagades and VAS before and after treatment. The occurrence of ADR was compared among 3 groups. RESULTS:The total effective rate of treatment group was 68.09%,which was significantly higher than that of group A(42.22%)and control group B(16.28%),with statistical significance(P<0.05). There was no statistical significance in the scores of pruritus,skin lesion area,keratinization,rhagades and VAS among 3 groups before treatment(P>0.05). After treatment,above scores of 3 groups decreased significantly,and those of treatment group were significant-ly lower than those of control group A and B,with statistical significance(P<0.05). There was no statistical significance in the inci-dence of ADR among 3 groups(P>0.05). CONCLUSIONS:Ebastine tablet combined with Chushi zhiyang ointment is effective for hand keratinizing chapped eczema,and can significantly improve the skin of patients with good safety.
5.Effects of Repetitive Transcranial Magnetic Stimulation on Locomotor Outcome of Spinal Cord Injured Rats
Xin ZHANG ; Jianjun LI ; Xiaolin HUO ; Hong DAI ; Lidong PAN
Chinese Journal of Rehabilitation Theory and Practice 2008;14(3):228-230
Objective To explore the effect of repetitive transcranial magnetic stimulation(rTMS)on spinal cord injured rats.Methods Weight-drop spinal cord injury model was made at thoracic 10 segments with NYU impactor device.Stimulated group received daily superthreshold rTMS continued for 4 weeks.BBB locomotor scores were recorded weekly.Growth associated protein 43(GAP43)and 5-hydroxytryptamine(5-HT)were detected with immunofluorescence staining in the area of rostral and caudal to the lesion.Results The BBB scores in stimulation group improved compared with that in the control(P<0.01).GAP43 and 5-HT markers increased in the stimulation group(P<0.01),and they increased in the rostral than in the caudal areas(P<0.01).Conclusion rTMS can improve the locomotor function of incomplete spinal cord injury rats,which may result from the increase of expression of GAP43 and 5-HT.
6.Effect of Repetitive Transcranial Magnetic Stimulation on Spinal Segmental Excitability of Spinal Cord Injury Rats
Xin ZHANG ; Jianjun LI ; Xiaolin HUO ; Hong DAI ; Lidong PAN
Chinese Journal of Rehabilitation Theory and Practice 2007;13(3):240-242
Objective To investigate the effect of repetitive transcranial magnetic stimulation(rTMS)on the spinal segmental excitability after spinal cord injury in adult rats.MethodsT 10 spinal cord injury models were made with weight-drop method.8 weeks later,rTMS were applied to the experimental group at 0.5 Hz suprathreshold stimulation,500 pulses daily for 4 weeks.Spinal cord injury rats without stimulation and normal rats were used as controls.At different time points,electronic evoked F-wave were measured.The ratio of F-wave amplitude to M-wave amplitude(F/M)were compared among these groups.Immunohistochemistry was used to detect the expression of 5-hydroxytryptamine(5-HT)in the rostral and caudal lesion segments.ResultsThe ratio of F/M increased significantly(P<0.01)8 weeks after spinal cord injury compared with baseline ratio and regressed significantly(P<0.01)after 4 weeks of rTMS.Expression of 5-HT in grey matter around lesion was decreased after spinal cord injury and increased significantly(P<0.01)both in the rostral and caudal lesion segments in rTMS treatment group.ConclusionThe increased spinal segmental excitability after spinal cord injury can be regressed by rTMS,which may be resulted in increased expression of 5-HT.
7.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
8.Pathological evaluation of immune system in drug safety study
Zhi LIN ; Jianjun LV ; Zhe QU ; Guitao HUO ; Di ZHENG ; Yanwei YANG ; Xue WANG ; Bo LI
Drug Evaluation Research 2017;40(1):1-4
The immune system is a complex system involving multiple organs,and it is vulnerable to age,gender,environment and other factors.For a variation normal physiological range,it is a great challenge to evaluate drug-induced immunotoxicity in preclinical safety study.Histomorphologic assessment of the immune system is a recognized cornerstone in the identification of immunotoxicity at present.In this paper,the principles of pathological evaluation for immune system,and pathological evaluation for important immune organs including thymus,spleen,lymph nodes are discussed briefly,so that it is intended to assist toxicity pathologists in the accurate and consistent characterization of intended and unintended drug-induced alterations of the immune system.
9.Meta analysis of unipolar versus bipolar hemiarthroplasty for elderly patients with femoral neck fracture
Jiangtao CHEN ; Jianjun HUO ; Chuanhui XUN ; Li CAO ; Xinghua SONG ; Zheng TIAN
Chinese Journal of Trauma 2014;30(9):917-923
Objective To evaluate the effect of unipolar versus bipolar hemiarthroplasty for treatment of femoral neck fracture in the elderly Methods Related randomized controlled trials (RCTs) and quasi-randomized controlled trials (qRCTs) were searched from computerized databases MEDLINE,EMBASE,Cochrane Library,and CBM disc.Additional studies were identified through hand searches of 10 domestic journals.Time period of the search was from 1966 to June 2012.RevMan 4.2.8 software was used for data analysis.Results A total of 7 RCTs and 3 qRCTs were included.In this meta analysis,bipolar hemiarthroplasty was associated with better hip function compared with unipolar hemiarthroplasty at postoperative 6 months (RR =0.74,95% CI0.62-0.88,P < 0.01).However,the two procedures revealed no significant differences in terms of postoperative one-year dislocation rate (RR =1.01,95% CI0.54-1.89,P > 0.05),reoperation rate (RR =1.13,95% CI 0.74-1.72,P > 0.05),major complication incidence (except for dislocation) (RR =1.27,95% CI 0.74-2.18,P > 0.05),and postoperative 2-year mortality (RR1.16,95% CI 0.73-1.87,P > 0.05).Conclusion Bipolar hemiarthroplasty is preferable to unipolar hemiarthroplasty for hip function improvement,but postoperative one-year dislocation rate,reoperation rate,major complication incidence (except for dislocation),and postoperative twoyear mortality are similar for the two procedures.
10.An application of DNA barcoding in identification of Cricetulus Barabensis
Baobao CHEN ; Cuihong AN ; Yangxin SUN ; Suoping FAN ; Lixia HUO ; Wen LYU ; Jianjun SHE
Chinese Journal of Endemiology 2016;35(5):325-328
Objective To apply DNA barcoding technology for exploring its taxonomic status and differences in the molecular biology of Cricetulus barabensis in Shaanxi Province.Methods Sixty-five samples of Cricetulus barabensis were collected from Dingbian,Jingbian Counties in northern of Shaanxi and Dali County in Guanzhong plain (Dingbian 58 samples,Jingbian 2 samples,and Dali 5 samples).According to the mitochondrial cytochrome C oxidase subunit I gene (CO I) sequence,the genetic distance was calculated and Neighbor-Joining tree was constructed.Results The genetic distance between two samples (13.16,13.21) and other 56 samples of Dingbian was 9.2%-10.0%.The genetic distance between the 56 samples of Dingbian and Jingbian was less than 1% and Dali was 7.2%-8.3%;the average intraspecific genetic distance of Jingbian and Dali was less than 1%.The Neighbor-Joining tree showed that all the Cricetulus barabensis samples from the three counties were separated into two large branches.The samples of 13.16,13.21 from Dingbian together were classified into a class and the rest of the samples into another separate branch.At the same time,other samples from Dingbian except 13.16,13.21 and Jingbian were distributed in a small branch,and Dali samples were occupied another small branch.Conclusion Using the DNA barcoding technology,we have determined three subspecies of Cricetulus barabensis in Shaanxi Province,Dingbian has two kinds and Dali has a different subspecies.