Objective: To establish a method for determining the content of bear bile powder in Longze Xiongdan capsules with taursodeoxycholic acid（TUDCA） and taurchenodeoxycholic acid（TCDCA） as indexes.
Methods: HPLC series evaporation photodetector was adopted on Chrom Core AQ C₁₈ column(4.6 mm×250 mm, 5 μm), with the mobile phase comprising of acetonitrile ( A ) and 5 mmol·L^-1 ammonium acetate solution (B) in a gradient elution (0-40 min, 25%A; 40-50 min, 25%A→29%A; 50-80 min, 29%A; 80-100 min, 29%A→40%A) at the flow rate of 1.0 mL·min^-1. The column temperature was 30 ℃. The ELSD was used, of which the drift tube temperature was 110 ℃ and the flow rate of carrier gas（N₂） was 2.5 L·min^-1.
Results: In the ranges of 1.069-9.57 μg and 0.740 46-7.404 64 μg, logarithms of the injected amount of TUDCA and TCDCA presented good linear relationships with logarithms of the peak area, respectively. The RSDs of precision, repeatability and stability tests were all lower than 2.0%. At three concentration levels the recoveries of TUDCA and TCDCA were 95.2%-97.7% and 91.9%-95.9%, respectively. Samples of 42 batches showed that the contents of TUDCA and TCDCA were 0.18-0.43 and 0.10-0.44 mg·granule^-1, respectively.
Conclusion: This method can be used for the quality control of bear bile powder in Longze Xiongdan capsules, thus provides a scientific basis for improving its quality standard.

OBJECTIVETo introduce and evaluate the technical feasibility and anatomical and functional outcomes of one-stage vaginoplasty with autologous buccal micromucosa combined with acellular allogenic dermis.

METHODSWe retrospectively reviewed our experiences with 17 patients with Mayer- Rokitansky-Kuster-Hauser syndrome treated with primary surgery from September 2010 to April 2013. All patients underwent vaginoplasty with autologous buccal micromucosa combined with acellular allogenic dermis. We describe the details of this technique, observe the time of epithelization and evaluate the long- term anatomical, functional, and sexual outcomes.

RESULTSThe time of epithelization was 13 d (range: 12-15 d). At a mean follow-up of 15 months (range: 12-24 months), the mean postoperative dependence on the vaginal stent was 11.7 ± 1.64 months (range: 9-15 months), the mean depth of the neovagina was (9.0 ± 0.94) cm (range: 7-11 cm), the mean circumference was (12.3 ± 1.36) cm (range: 10.0-14.5 cm) and the mean volume was (105 ± 10) ml (range 85-120 ml). The mean female sexual function index score of the 12 sexually active patients was 29.5 ± 2.6. No spouse reported discomfort during intercourse.

CONCLUSIONSVaginoplasty with autologous buccal micromucosa combined with acellular allogenic dermis is an effective and feasible approach for patients with Mayer-Rokitansky-Kuster-Hauser syndrome. The procedure has satisfactory long-term anatomical and functional results. The use of the acellular allogenic dermis is limited by the high price and the potential infection.

46, XX Disorders of Sex Development ; surgery ; Acellular Dermis ; Coitus ; Congenital Abnormalities ; surgery ; Feasibility Studies ; Female ; Humans ; Mouth Mucosa ; transplantation ; Mullerian Ducts ; abnormalities ; surgery ; Postoperative Period ; Reconstructive Surgical Procedures ; methods ; Retrospective Studies ; Vagina ; abnormalities ; surgery

Aim To explore the protective effects of LPPC ( procyanidins extracted from the litchi pericarp) on cardiomyocyte apoptosis in septic rats and its mech-anisms. Methods The rats were randomly divided in-to 5 groups, and were given orally the drug for two weeks continuously. The control group ( control) and sepsis model group ( LPS ) were given distilled water once a day. LPPC low, medium and high dose groups were given LPPC 50 , 100 , 200 mg · kg-1 · d-1 re-spectively which were prepared freshly every day. After the treatment, sepsis animal models were established. Except for the control group, other groups were injec-ted LPS (lipopolysacchride, 10mg·kg-1) intraperito-neally to induce acute sepsis model. 4hrs later, rat se-rum was collected, isoenzyme ( CK-MB ) , lactate de-hydrogenase ( LDH ) and activity of aspertate amin-otransferase ( AST/GOT) were detected. Then rat car-diac tissue was obtained and cardiac tissue malondial-dehyde ( MDA ) , total antioxidant capacity ( T-AOC ) and reduced glutathione ( GSH ) content were deter-mined. TUNEL staining was performed to analyze the apoptosis of myocardial cells. Cleaved caspase-3 and TNF alpha protein expressions were analyzed by West-ern blot. Results Compared with the control group ( control) , serum of sepsis model group rats CK-MB, LDH, AST/GOT and cardiac tissue MDA content were significantly increased (P<0. 01). At the same time, the activity of cardiac tissue T-AOC and GSH de-creased obviously ( P<0. 01 ) . The apoptotic myocar-dial cells increased significantly ( P<0. 01 ) , and the expression level of cleaved caspase-3 and TNF alpha decreased obviously ( P <0. 01 ) . LPPC pretreatment significantly decreased the serum CK-MB, LDH, AST/GOT and tissue MDA content, increased tissue T AOC and GSH activity, attenuated apoptosis of rat myocardi-al cells significantly, and decreased expression level of cleaved caspase-3 and TNF alpha. Conclusion LPPC pretreatment can significantly attenuate rat myocardial cell apoptosis induced by sepsis, and the underlying mechanisms may be related to its anti-oxidative effects.

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

Objective To compare the safety and effectiveness of drug-eluting balloon (DEB) with paclitaxel and drug eluting stent (DES) in treating in-stent restenosis (ISR).Methods The clinical data of a total of 76 patients with ISR,who were admitted to authors' hospital to receive stem implantation during the period from January 2012 to September 2014,were retrospectively analyzed.According to the therapeutic means,the patients were divided into paclitaxel DEB group (n=32) and paclitaxel DES group (n=44).The general clinical information and coronary artery angiography findings were collected.The patients were followed up for one year;the all-cause mortality,cardiac death,myocardial infarction,in-stent thrombosis,target lesion revascularization,target vessel revascularization,and major adverse cardiac events were documented.Results No obvious difference in the general data of patients existed between group DEB and group DES (P＞0.05).The incidences of left anterior descending artery ISR in DEB group and in DES group were 43.75％ and 47.73％ respectively.The ISR target vessel types of the two groups were quite similar (P＞0.05).No statistically significant differences in ISR type,ISR lesion type and characteristics of in-stent restenosis existed between the two groups (P＞0.05).One-year following-up examinations indicated that no statistically significant differences in all-cause mortality,cardiac death,myocardial infarction,in-stent thrombosis,target lesion revascularization,target vessel revascularization,and major adverse cardiac events existed between the two groups (P＞0.05).Further analysis revealed that no significant difference in event-free survival existed between the two groups (P＞0.05).Conclusion For the treatment of ISR,the use of paclitaxel DEB is safe and feasible,its curative effect is not less than DES.

OBJECTIVETo evaluate the restoration of function after spinal cord injury (SCI) in patients of different ages who have underwent intraspinal transplantation of olfactory ensheathing cells (OECs).

METHODSOne hundred and seventy-one SCI patients were included in this study. Of them, 139 were male and 32 were female, with age ranging from 2 to 64 years (mean, 34.9 years). In all SCI patients the lesions were injected at the time of operation with OECs. According to their ages, the patients were divided into 5 groups: 51 years group (n = 14). The spinal cord function was assessed based on the American Spinal Injury Association (ASIA) Classification System before and 2 - 8 weeks after OECs transplantation. One-way ANOVA and q test were used for statistical analysis, and the data were expressed as mean +/- SD.

RESULTSAfter surgery, the motor scores increased by 5.2 +/- 4.8, 8.6 +/- 8.0, 8.3 +/- 8.8, 5.7 +/- 7.3 and 8.2 +/- 7.6 in 5 age groups respectively (F = 1.009, P = 0.404); light touch scores increased by 13.9 +/- 8.1, 15.5 +/- 14.3, 12.0 +/- 14.4, 14.1 +/- 18.5 and 24.8 +/- 25.3 respectively (F = 1.837, P = 0.124); and pin prick scores increased by 11.1 +/- 7.9, 17.2 +/- 14.3, 13.2 +/- 11.8, 13.6 +/- 13.9 and 25.4 +/- 24.3 respectively (F = 2.651, P = 0.035). Restoration of pin prick in > 51 years group was better than other age groups except 21 - 30 years group.

CONCLUSIONOECs transplantation can improve the neurological function of spinal cord of SCI patients regardless of their ages. Further research into the long-term outcomes of the treatment will be required.

Adolescent ; Adult ; Age Factors ; Child ; Child, Preschool ; Female ; Humans ; Male ; Middle Aged ; Olfactory Bulb ; cytology ; transplantation ; Spinal Cord ; physiology ; Spinal Cord Injuries ; surgery ; Treatment Outcome

Objective To investigate the quantity and function of CD8+T cells in peripheral blood of pa-tients with repeated implantation failure(RIF).Methods Thirty-seven patients with RIF and 19 healthy controls were enrolled in this study.The peripheral blood and endometrium were collected during the mid-luteal phase.The percentage of peripheral CD8+T subsets and the levels of perforin and granzyme B of peripheral CD8+T cells were determined by flow cytometry assay.The percentage of endometrial CD8+T cells was detected by IHC,the produc-tion of perforin and granzyme B of endometrial CD8+T cells was detected by IF. Results Compared with the con-trol group,the percentage of peripheral CD8+T cells in patients with RIF was not significantly changed(37.22% vs. 37.15%,P>0.05).However,the porportion of endometrial CD8+T cells in the RIF group was higher than that in the control group(1.99% vs.3.77%,P<0.001).The levels of perforin and granzyme B in peripheral blood and en-dometrial CD8+T cells in patients with RIF were similar with those in the control group.Conclusions Compared to the control group,the percentage of endometrial CD8+T was markedly upregulated in patients with RIF.However, the production of perforin and granzyme B were similar between the control group and the RIF group.