1.Relationship of doctor's occupational burnout with organizational factors
Chinese Journal of Behavioral Medicine and Brain Science 2009;18(1):54-56
ObjectiveTo explore the relationship of organizational factors with occupational burnout among doctors. Method740 doctors were assessed by CMBI, Job Demands and Decision Latitude scale, Distributive and Procedural Justice scale, Cross-Culture Role Conflict, Ambiguity, and Overload scale, Work Interference With Family and Family Interference With Work scale, Social Support scale. ResultsHierarchical multiple regression indicated that 27.8% variance of doctors' Emotional Exhaustion(EE), 36.8% variance of Depersonalization(Dp), 21.0% variance of Reduced Personal Accomplishment(RPA) were explained by Organizational factors. Work Interference with family, role conflict, work-family conflict, distributive justice and workload can significantly predict EE(Standardized β was 0.204, 0.102, 0.249,-0.109,0.093); Family interference with work, role ambiguity, family support, procedural justice and workload can significantly predict Dp(Standardized β was 0.506,0.192,-0.122,0.105,-0.068); Role ambiguity, family support, job control, work Interference with family and superior support can significantly predict RPA(Standardized β was 0.245,-0.179,-0.172,-0.106,-0.069). ConclusionOrganizational factors have significantly effect on doctor's burnout, especially work-family conflict and role character.
2.Advices to clinical microbiology professional who participated in the infectious diseases consult
Chinese Journal of Laboratory Medicine 2014;37(12):982-986
Clinical microbiology should participate the infectious diseases consult.There is no guideline about this topic in the professional field so far.The professional recommendations are given to the different items including definition,professional,prerequisite,pre-consult phase,consult phase,post-consult phase,and etc.It is hoped that our recommendations are conducive to the consult task and can promote the development of clinical microbiology and infectious diseases.
3.Application of GnRH analogues in treatment of ovarian cancer
Academic Journal of Second Military Medical University 2001;0(09):-
Ovarian cancer is sex hormone-Dependent.Gonadotropin releasing hormone (GnRH) analogues inhibit ovarian cancer not only through the hypothalamus-pituitary-gonadal axis, but also through directly inhibiting the proliferation and inducing the apoptosis via GnRH receptors on the ovarian carcinoma cells.In addition, GnRH analogues target GnRH receptors on the cancer cells and can serve as a carrier for cytotoxic agents, improving the efficiency of cytotoxic agents and lowering the side effect.In a word, treatment with GnRH analogues may be a valuable alternative for advanced and recurrent ovarian cancer.
4.Analysis on Occupational Burnout of Psychiatrists and It's Related Factors
Chinese Journal of Clinical Psychology 1993;0(01):-
Objective:To investigate the characteristics of occupational burnout of psychiatrists,and explore its organi-zational factors.Methods:106 psychiatrists were assessed by CMBI,Job Demands and Decision Latitude scale,Distributive and Procedural Justice scale,Cross-Culture Role Conflict,Ambiguity,and Overload scale,Work Interference with Family and Family Interference with Work scale,Social Support scale.Results:Hierarchical multiple regression indicated that work interference with family,role conflict,workload and role ambiguity could significantly predict emotional exhaustion;family interference with work could significantly predict depersonalization;colleague support and role ambiguity could significantly predict reduced personal accomplishment.Conclusion:Status of reduced personal accomplishment of psychiatrists is serious.Occupational burnout has particular related factors.
5.GnRH analog resensitizes cisplatin-resistant human ovarian cancer cells
Dan WANG ; Ning HUI ; Dong WU ;
Academic Journal of Second Military Medical University 1981;0(04):-
Objective:To study the effect of GnRH analog triptorelin in resensitizing cisplatin-resistant human ovarian canc- er cells and to discuss the related mechanism.Methods:Cisplatin-resistant human ovarian cancer cell line OVCAR-3/CDDP was established in vitro.MTT assay was used to assess the inhibitory effects of triptorelin,cisplatin alone or a combination of both on OVCAR-3/CDDP cells.Flow cytometry was employed to observe the expression changes in epidermal growth factor receptor (EGFR)in different groups.Results:The drug restant index of OVCAR-3/CDDP cells was 13.42.The resensitizing fold of cisplatin combined with triptorelin was 3.80.The expression of EGFR had the most prominent decrease in OVCAR-3/CDDP cells in the combination group.Conclusion:Triptorelin can partially resensitize cisplatin-resistant OVCAR-3/CDDP cells,which might be related to the down-regulation of EGFR.
6.Expression of glypican-3 in ovarian carcinoma and its clinical significance
Li WANG ; Ning HUI ; Xiaobo MAN
Medical Journal of Chinese People's Liberation Army 2001;0(10):-
Objective To study the expression of GPC3 mRNA and GPC3 protein in ovarian carcinoma, and to investigate the clinical significance of their expression. Methods 35 specimens of ovarian carcinomas and 23 specimens of normal ovarian tissues were obtained from the patients undergoing operation during Jan. 2004 to Oct. 2005. The expressions of GPC3 mRNA in ovarian carcinomas and normal ovarian tissues were detected by real-time fluorescence quantitative PCR (RT-PCR). The clinical and pathological characteristics of ovarian carcinomas were analyzed. The expression of GPC3 protein was detected in 4 specimens of ovarian carcinomas and 3 specimens of normal ovarian tissues by Western bloting. Results The expression level of GPC3 mRNA in ovarian carcinomatous was down-regulated compared with that in normal ovarian tissues (P0.05). The expression of GPC3 protein was consistent with the expression of GPC3 mRNA. GPC3 protein was doubly or trebly expressed in normal ovarian tissues compared with ovarian carcinomas. Conclusion The present study suggests that GPC3 may be related to the occurrence and development of the ovarian carcinoma. The simultaneous determination of GPC3 and CA125 may increase the sensitivity of diagnosis for ovarian carcinoma.
7.The changes of CT values in liver parenchyma and its pathogenesis after treatment of acute pancreatitis
Wu NING ; Yongqian QIANG ; Xianning LI ; Hui NING ; Xiaojiang QI ; Qianjin SHAN ; Ning WANG
Journal of Practical Radiology 2015;(4):596-599,629
Objective To probe the changes of CT values in liver parenchyma in order to evaluate the therapeutic effect of acute pancreatitis.Methods 104 patients with acute pancreatitis which were diagnosed and treated by department of gastroenterology.Ac-cording to pathological results,the patients were divided into mild acute pancreatitis (MAP)group and severe acute pancreatitis (SAP)one.The CT values of liver parenchyma were measured before and after treatment,and the correlations between CT values changes and the amylase in blood and urine were analyzed.Results The CT values of liver parenchyma showed a negative correlation with the pathological severity of acute pancreatitis (r=-0.089,P <0.05).The accuracy using the changes of CT values to evaluate the therapeutic effect was significantly different between the MAP and the SAP group with different sensitivity of 92.2% and 85.7%and specificity of 33.3% and 94.1% respectively.In addition,the changed trend of CT values in liver parenchyma showed negative correlations with triglycerides and blood amylase.Conclusion CT scan is a useful imaging method in evaluating the liver damage and the therapeutic effect in patients with acute pancreatitis in emergency.
8.Study of β-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 2001;17(3):226-229
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.
9.Clinical characteristics and prognostic factors of primary signet-ring cell adenocarcinoma of the lung: a report of 22 cases
Hui NING ; Yi XIE ; Chengzhi WANG ; Wanpeng WU
Tumor 2009;(7):684-686
Objective:To investigate the clinical characteristics and prognostic factors of primary signet-ring cell adenocarcinoma of lung. Methods:The clinical features of 22 patients with primary signet-ring cell adenocarcinoma of lung from the year 1981 to 2007 were analyzed retrospectively and made a statistical analysis on the prognostic factors. Results:Postoperative pathologic examination was an important method to confirm the primary signet-ring cell adenocarcinoma of lung and surgery was the main therapeutic approach. The 1-, 3-, and 5-year survival rates were 63.0%, 53.3%, and 37.7%, respectively. Statistical analysis indicated that smoking, tumor size, complete resection, and tumor staging were the independent prognostic factors for patients with primary signet-ring adenocarcinoma of lung.Conclusion:The primary signet-ring cell adenocarcinoma of lung has higher malignancy. Invasion and migration frequently occur. Its prognosis is poor.
10.Research and Progress on Feed Phytase Reform by Protein Engineering
Hui CHEN ; Hong-Ning WANG ; Qi WU ; Hai-Xia ZHAO ;
Microbiology 1992;0(03):-
As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.