Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Objective To explore the distribution of traditional Chinese medicine(TCM)syndrome elements in patients with multi-drug resistant bacteria-infected pneumonia.Methods Clinical data of 126 patients with multi-drug resistant bacteria-infected pneumonia admitted to the intensive care unit of Lung Disease Centre of Qingdao Hospital of Traditional Chinese Medicine from May 2020 to July 2022 were retrospectively collected.The clinical data included the patients'gender,age,underlying diseases,history of bad additions of smoking and alcohol,multi-drug resistant bacteria,and the information of four diagnostic methods of TCM,etc.The disease-nature syndrome elements in patients with drug-resistance to various strains of drug-resistant bacteria were extracted,and then deficiency-excess syndrome differentiation was carried out.Results(1)A total of 201 strains of multi-drug resistant bacteria were detected in 126 patients with multi-drug resistant bacterial pneumonia.The main pathogenic species were Gram-negative bacteria,and the proportion accounted for 95.52%(192/201),which was significantly higher than that of Gram-positive bacteria[4.48%(9/201)],with a statistically significant difference(χ2 = 166.612,P＜0.001).Klebsiella pneumoniae accounted for the highest percentage of 23.38%in the gram-negative bacterium.(2)A total of 12 syndrome elements were extracted from the 126 patients.The excess syndrome elements were predominated by phlegm and heat,and the deficiency syndrome elements were predominated by yin deficiency.There was no statistically significant difference in the distribution of yin deficiency,blood deficiency,heat,phlegm,fluid-retention and damp syndrome elements among patients with different strains of drug-resistant bacterial infection(P＞0.05).(3)Of the 126 patients,62 cases(49.21%)had simple excess syndrome,one case(0.79%)had simple deficiency syndrome,and 63 cases(50.00%)had concurrent deficiency-excess syndrome.Among the 126 patients,there were 19 cases of single syndrome element,41 cases of concurrent two-syndrome element,49 cases of concurrent three-syndrome element,16 cases of concurrent four-syndrome element,and one case of concurrent five-syndrome element.And the combined syndrome element of phlegm-heat-yin deficiency occurred most frequently for 26 times.Conclusion Gram-negative bacteria are the primary infectious pathogens for the patients with multi-drug resistant bacterial infections,and the TCM syndrome elements of the patients are characterized by the concurrence of deficiency and excess and simple excess syndrome,mainly manifesting as phlegm,heat,and yin deficiency.

Objective To investigate disease characteristics and hospitalization costs of children with Mycoplasma Pneumoniae pneumonia(MPP)admitted to Shanghai municipal medical hospitals from 2019 to 2023.Methods Depending on the Shanghai Municipal Hospital Pediatric Alliance,we retrospectively investigated community acquired MPP pediatric patients hospitalized in 22 municipal hospitals with pediatric qualifications(including 4 children's hospitals)in Shanghai from Jan 2019 to Dec 2023.We collected the patients'diagnosis codes,gender,age,length of hospital stay,hospitalization costs,and whether they progressed to severe Mycoplasma pneumoniae pneumonia(SMPP).Results From 2019 to 2023,a total of 29 045 hospitalized children with MPP were treated,with 6 035 cases(20.8%)identified as SMPP in the 22 hospitals.Trend analysis revealed a rising trend with years in the proportion of SMPP patients(χ2trend=365.498,P<0.001).Among the 4 children's hospitals,there were 18 710 cases with MPP,including 4 078 cases(21.8%)of SMPP.The proportion of SMPP patients also showed an increasing trend with years(χ2trend=14.548,P<0.001),and the proportion in 2023(23.0%)was higher than that in previous years with statistical significance.There were statistical differences in the seasonal distribution of MPP cases between different years,with higher proportions in summer and autumn overall.The age distribution of hospitalized MPP children varied among different years,with school-age children accounting for the majority(56.8%)in 2023.There was no difference in the distribution of severe cases between different genders,but there were differences in the proportion of severe cases among different age groups in different years,with a gradual increase in severe cases among children aged 1 to 3 years(χ2trend=191.567,P<0.001).The average length of hospital stay for MPP during the epidemic was higher than that during non-epidemic periods,and there were statistically significant differences in the average length of hospital stay between different years(P<0.001).The individual hospitalization costs during the epidemic were higher than in other years,and there were statistically significant differences in individual hospitalization costs between different years(P<0.001).The total hospitalization costs were still higher in 2019 and 2023.The individual hospitalization costs for SMPP were higher than for non-SMPP cases.Conclusion MPP outbreaks occurred in Shanghai in 2019 and 2023,with the higher proportions in summer and autumn overall.Compared to previous years,the number of hospitalized MPP children in Shanghai was higher in 2023,with a higher proportion of SMPP cases,especially among children under 3 years old.The individual per capita hospitalization expenses for SMPP cases were higher than for non-SMPP cases.

Objective To explore characteristics of co-infection of Chlamydia pneumoniae(Cpn)and severe acute respiratory syndrome coronavirus 2(SARS-CoV-2),and identify their effect on SARS-CoV-2-induced inflammatory response.Methods Patients with coronavirus disease 2019(COVID-19)who received treatment in a hospital in Chenzhou City from December 20,2022 to February 20,2023 were selected.According to the severity of COVID-19,severe and critical cases were classified as the severe symptom group,while mild and moderate cases were classified as the mild symptom group.Meanwhile,according to the age of patients(≥18 years old as adults,＜18 years old as juveniles),they were divided into the adult severe symptom group,adult mild symptom group,juvenile severe symptom group,and juvenile mild symptom group.Propensity score was adopted to match age,gender,and under-lying diseases of patients in severe symptom and mild symptom group in a 1∶1 ratio.Bronchoalveolar lavage fluid(BALF),throat swabs,and serum specimens of patients were collected.Cpn IgG/IgM antibody was detected by enzyme-linked immunosorbent assay(ELISA),levels of 12 common cytokines(including interleukin-8[IL-8])in BALF were detected by flow cytometry,differences among groups were compared.Results A total of 102 patients were included,with 61 severe and critical(severe symptom)patients,as well as 41 mild and moderate(mild symp-tom)patients.There were 71 patients aged ≥18 years and 31 juvenile patients aged＜18 years.There were 39 pa-tients in the adult severe symptom group and 32 in the adult mild symptom group,and 30 pairs were successfully matched through propensity score analysis.There were 22 patients in the juvenile severe symptom group and 9 in the juvenile mild symptom group,and 8 pairs were successfully matched through propensity score analysis.Among COVID-19 patients,the positive rates of Cpn IgG and IgM were 36.27％(n=37)and 8.82％(n=9),respective-ly,with 1 case positive for both Cpn IgG and IgM.The level of interferon(IFN)-α in serum specimens from adult patients with severe symptom combined with positive Cpn IgG was higher than that of IgG negative patients(P=0.037).There was no statistically significant difference in the levels of other cytokines in BALF and serum speci-mens between the two groups of patients(all P＞0.05).The levels of IL-8 and IL-17 in serum specimens of patients with positive Cpn IgG in the adult mild symptom group were both higher than those in Cpn IgG negative patients(both P＜0.05).The levels of IL-8 in both BALF and serum specimens from Cpn IgM positivity patients in the ju-venile mild symptom group were higher than those from patients with negative Cpn IgM(both P＜0.05).Logistic regression analysis results showed that Cpn IgG and IgM positivity were not risk factors for the development of se-vere COVID-19.Conclusion Combined Cpn infection is not a risk factor for the development of severe symptom in COVID-19 patients,and Cpn infection has limited impact on the secretion of inflammatory factors caused by SARS-CoV-2.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

The traditional Chinese medicine Atractlodis Rhizoma is the dried rhizome of the Asteraceae herbal plant Atractylodes lancea, and it has the functions of drying dampness and strengthening the spleen, removing wind and dissipating cold, and brightening the eyes. The sesquiterpenoids in A. lancea are the main ingredients of its pharmacological activities in clinical practice, including atractylone, β-eudesmol, and hinesol, which possess anti-inflammation, antibacterial, antiviral, and hepatoprotective effects. This study focused on the biosynthesis of sesquiterpenoids in A. lancea, summarized the proportion of the main active ingredients in A. lancea from the genuine region and the non-genuine region, elaborated on the research progress of genes related to biosynthesis pathways, and systematically sorted out the biotic and abiotic factors affecting their biosynthesis, so as to provide a theoretical basis for further research on the biosynthetic mechanism of sesquiterpenoids in A. lancea and development of high-quality medicinal materials of A. lancea.
Atractylodes/metabolism* ; Sesquiterpenes/metabolism* ; Drugs, Chinese Herbal/pharmacology* ; Biosynthetic Pathways

OBJECTIVE: To retrospectively analyze the clinical efficacy of anterior cruciate ligament (ACL) reconstruction combined with anterolateral complex repair and ACL reconstruction combined with ALL reconstruction in the treatment of anterior cruciate ligament injuries with high-grade pivot shift. METHODS: From January 2018 to June 2022, 49 patients combined ACL and ALL injuries with high-grade pivot shift were retrospectively studied from three hospitals, 29 of them underwent ACL reconstruction with anterolateral complex repair (repair group), including 23 males and 6 females with an average age of (27.5±4.8) years old, ranged from 20 to 37 years old;the injured sides were 13 on the left and 16 on the right, and 11 patients were suffered with meniscus injury. The other 20 patients underwent ACL and ALL reconstruction (reconstruction group) including 17 males and 3 females with the mean age of (27.1±4.5) years old, ranged from 20 to 38 years old;the injured sides were 8 on the left and 12 on the right, and 6 patients were suffered with meniscus injury. Knee stability (pivot shift test, KT-2000), range of motion, knee function (Lysholm scoring scale, Cincinnati sports activity scale (CSAS) scoring scale, and Tegner activity level score between two groups were compared. RESULTS: A total of 49 patients were followed up, the repair group receiving 13 to 20(15.3±1.8) months and the reconstruction group receiving 12 to 21(16.0±2.2) months. There was no statistically significant difference in the preoperative pivot shift test grading distribution between two groups (P>0.05). At the last postoperative follow-up, there were 24 patients with grade 0 and 5 patients with grade 1 in the repair group, and there were 18 patients with grade 0 and 2 patients with grade 1 in the reconstruction group, there is no significant difference in the distribution of axial shift test grading between two groups(P>0.05). The preoperative KT-2000 tibial displacement of two groups were (9.39±0.77) mm (repair group) and (9.14±0.78) mm (reconstruction group) respectively, with no statistically significant difference (P>0.05). At the final postoperative follow-up, there were 24 patients with KT-2000 tibial displacement <3 mm and 5 patients with 3 to 5 mm in the repair group, while 18 patients with <3 mm and 2 patients with 3 to 5 mm in the reconstruction group, KT-2000 tibial displacement distribution of two groups was no significant difference (P>0.05), but the KT-2000 tibial displacement in the reconstruction group (1.30±0.86) mm was significantly smaller than that in the repair group (1.99±1.11) mm (P<0.05). The final postoperative follow-up range of motion of the contralateral side knee between two groups was no significant difference (P>0.05). The range of motion of the suffering knee in the repair group was less than that in the reconstruction group (P<0.05). There was no significant difference in preoperative Lysholm and CSAS scores between two groups (P>0.05). At the final postoperative follow-up, both groups showed significant improvement in Lysholm and CSAS scores, while the Lysholm and CSAS scores of the reconstruction group were better than those of the repair group, and the difference was statistically significant (P<0.05). Significant differences was found in Tegner scores between two groups, which 16 patients in the repair group returned to their pre-injury activity level, and 17 patients in the reconstruction group returned to their pre-injury level (P<0.05). CONCLUSION Compared to anterolateral complex repair, combined ACL and ALL reconstruction in the treatment of ACL injuries with high-grade pivot shift results in better knee joint function and stability. This is advantageous in reducing the risk of ACL reconstruction failure.
Humans ; Male ; Female ; Adult ; Anterior Cruciate Ligament Reconstruction/methods* ; Anterior Cruciate Ligament Injuries/surgery* ; Young Adult ; Retrospective Studies ; Anterior Cruciate Ligament/surgery* ; Range of Motion, Articular