1.Transpedicular AF fixation in treatment of thoracolumbar fracture and dislocation
Yinshu CHENG ; Jin WU ; Ruixin TANG ;
Chinese Journal of Orthopaedic Trauma 2004;0(11):-
Objective To evaluate the clinical efficacy of AF (atlas fixator) internal fixation in treatment of thoracolumbar fracture and dislocation. Methods 42 cases of thoracolumbar fracture were treated by posterior AF internal fixation. Prior to surgery, anteroposterior and lateral radiographs, and CT scan through bone windows were done for all the patients. During surgery, all the pedicle screws were inserted by Mergerls method and proper insertion was confirmed by radiographs. Results The follow ups of 39 patients averaged 21 months (ranging from 6 to 29 months). After surgery, the correction of anterior vertebral body height averaged 40.2%, and of Cobbs angle 23.2?. 12 cases of incomplete spinal cord injury had significant improvement and 2 ones of complete spinal cord injury had no improvement. Conclusion The AF screw is especially helpful in reconstruction of stability of thoracolumbar region after posterior decompression and reduction, because it results in simplicity, safety, less fixation segments, and little invasion or bleeding.
2.Efficacy of integrated traditional Chinese medicine with Western medicine in patients with diarrhea-predominant irritable bowel syndrome and its relation to serum inflammatory cytokines
Shiwei TANG ; Ming CHENG ; Zhongping WU ; Yanyan HU ; Yurui PAN
Chinese Journal of General Practitioners 2017;16(7):522-526
Objective To investigate the efficacy of integrated traditional Chinese medicine (TCM) with Western medicine in treatment of diarrhea type irritable bowel syndrome (IBS-D) and its effect on serum inflammatory cytokine levels.Methods One hundred and sixty four IBS-D patients treated in Guangfu Hospital from July 2013 to August 2015 were randomly divided into study group and control group with 82 cases in each group.All patients received oral Saccharomyces boulardii 1.0 b.i.d, while patients in study group received additional Shuganjianpi decoction b.i.d for 4 weeks.The clinical efficacy was observed, serum IL-10, IFN-γ and TNF-α levels were measured in 2 groups.Results After treatment, the total score of clinical symptoms in study group was lower than that of control group [(5.71±1.41) vs.(11.70±2.88) points,t=16.707, P<0.01].Serum levels of IFN-γ, TNF-α in study group decreased significantly after treatment [IFN-γ (2.88±1.38) ng/L vs.(1.00±0.44) ng/L, t=11.609, P<0.01;TNF-α (41.26±5.29) ng/L vs.(24.13±3.27) ng/L,t=24.636, P<0.01], IL-10 significantly increased [(142.23±21.58) ng/L vs.(170.23±33.45) ng/L,t=6.291,P<0.01].The overall effective rate of study group was higher than that of control group, [87.50% (70/80) vs.68.75% (55/80), x2=8.228, P<0.01].After treatment, the quality of life scores in both groups were improved;but the improvement of diet, spirit, mood and sleep scores in study group were better than those in control group [(240±69) vs.(193±60), t=4.579, (316±74) vs.(230 ± 69), t=7.603, (297±62) vs.(228±59), t=7.211;(284±62) vs.(230±54), t=5.874, all P<0.01].Conclusion The efficacy of integrated traditional Chinese medicine with Western medicine in treatment of IBS-D is significantly better than that of Western medicine alone, which may be associated with its regulatory effect on the serum inflammatory cytokine levels.
3.Effects of Cell-wall-broken Extraction Process on Total Flavones of Pollen Typhae
Rongrong WANG ; Danfei CHENG ; Xusheng WU ; Jiancheng TANG
Traditional Chinese Drug Research & Clinical Pharmacology 2000;0(05):-
Alcohol-infusion. Conclusion: With the cell-wall-broken extraction process, a higher content of total flavones was obtained from Pollen Typhae .
5.Clinical observation on tuina plus foot bath with Chinese medicine for diabetic foot in early stage
Cheng-Hua XU ; Yun WU ; Nian-Tang YU ; Jing LU
Journal of Acupuncture and Tuina Science 2018;16(6):402-407
Objective:To observe the clinical effect of tuina plus foot bath with Chinese medicine for patients with diabetic foot (DF) in early stage.Methods:A total of 70 patients with early-stage DF were randomly allocated by the random number table into two groups,with 35 cases in each group.Patients in the control group received conventional medication,while patients in the observation group received tuina plus foot bath with Chinese medicine on the basis of conventional medication.The clinical efficacy was compared after 2 courses of treatment.Results:After treatment,intra-group comparisons of ankle-brachial index (ABI) showed statistical significance in both groups (both P<0.05).The curative rate was 83.3% in the observation group,with the total effective rate of 96.7%,versus 29.4% and 76.5% in the control group,respectively,and the between-group comparisons showed statistical significance (both P<0.05),indicating a better effect in the observation group.Conclusion:Tuina plus foot bath with Chinese medicine has a good therapeutic effect for DF patients in early stage.
6.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.
7.Study of children′s school phobia and its self-consciousness by sandplay therapy combined with family counseling
Jun LIU ; Cheng SU ; Fei WEN ; Wentao WU ; Ziying TANG
The Journal of Practical Medicine 2014;(11):1772-1774
Objective To explore the effectiveness of sandplay therapy combined with family counseling in children with school phobia and its influence of child′ self-consciousness. Methods Integrative sandplay therary with family consulting were used to treat 28 patients with school phobia regularly for 2 months. Sandplay and family consulting therapy were given once a week for 45 minutes . Clinical outcomes were assessed using CGI-GI and Piers-Harris children′s self-consciousness scale before and after treatment as well as 3 months posttreatment. Results Overall response rate was 85%. In addition, the physical appearance and characteristic factor before and after treatment were no significant difference (P>0.05). The rest of the various factors and total score compared with pre-treatment significantly improved (P<0.05). After treatment for 3 months, every factor in self-consciousness of children and total score were no significant difference (P>0.05). Conclusion Integrative sandplay therapy with family counseling has better and long-lasting treatment effect to self-consciousness of children with school refusal.
8.Electroacupuncture improves learning-memory of rats with low estrogen-induced cognitive impairment.
Xi TANG ; Cheng-Lin TANG ; Hong-Wu XIE ; Yun-E SONG
Acta Physiologica Sinica 2013;65(1):26-32
The present study was aimed to investigate the effect of electroacupuncture (EA) on learning-memory of rats with low estrogen-induced cognitive impairment and the possible mechanism. The rat model was established by ovariectomy, which resulted in low estrogen-induced cognitive impairment. EA was applied continuously for 3 months 2 weeks after ovariectomy. Morris water maze was used to test the ability of spatial learning and memory. Enzyme-linked immunosorbent assay (ELISA) and real-time quantitative RT-PCR were used to detect the concentration of serum estradiol (E2) and relative expression of choline acetyltransferase (ChAT) mRNA in hippocampus, respectively. The result showed that, compared with the sham group, the ovariectomy model group exhibited longer escape latency, reduced number of platform-crossing, lower concentration of serum E2, and decreased expression of ChAT mRNA in hippocampus. EA shortened the escape latency and increased the number of platform-crossing in the ovariectomy model group. Moreover, the concentration of serum E2 and the hippocampal expression of ChAT mRNA in the ovariectomy model group were significantly elevated by EA treatment. These results suggest EA is capable of improving learning and memory in ovariectomized rats, and the mechanism involves the up-regulation of the expression of ChAT mRNA in hippocampus induced by the increase of the serum concentration of estrogen.
Animals
;
Choline O-Acetyltransferase
;
metabolism
;
Cognition Disorders
;
therapy
;
Electroacupuncture
;
Estradiol
;
blood
;
deficiency
;
Female
;
Hippocampus
;
enzymology
;
Learning
;
Memory
;
Ovariectomy
;
RNA, Messenger
;
Rats
9.Relationship between Ulcerative Colitis and Lung Injuries.
Zhi-peng TANG ; Jia-wei WU ; Yan-cheng DAI ; Ya-li ZHANG ; Rong-rong BI
Chinese Medical Sciences Journal 2015;30(2):65-69
OBJECTIVETo explore the relationship between ulcerative colitis (UC) and lung injuries by assessing their clinical manifestations and characteristics.
METHODSFrom July 2009 to April 2012, 91 UC patients presenting to Longhua Hospital who met the established inclusion and exclusion criteria were enrolled in this retrospective study. According to the scores of disease activity index, the patients were divided into the mild, moderate, and severe groups. Meanwhile, the records of pulmonary symptoms, chest X-ray image, and pulmonary function were reviewed.
RESULTSSixty-eight (74.7%) patients had at least 1 pulmonary symptom, such as cough (38.5%), shortness of breath (27.5%), and expectoration (17.6%). And 77 (84.6%) had at least 1 ventilation abnormality. Vital capacity value was significantly lower in the severe group than that in the mild group (91.82%±10.38% vs. 98.92%±12.12%, P<0.05).
CONCLUSIONSLung injury is a common extraintestinal complication of UC. According to the theory in Traditional Chinese Medicine that the lung and large intestine are related, both the lungs and large intestine should be treated simultaneously.
Adult ; Colitis, Ulcerative ; complications ; physiopathology ; Female ; Humans ; Lung Injury ; etiology ; Male ; Middle Aged ; Vital Capacity
10.Influence on the adhesion and growth of dermal papilla cells by chondroitin sulfate and heparin sulfate
Bo CHENG ; Jinjin WU ; Yue MAI ; Rongqing LIU ; Baiyu ZHONG ; Shuqian TANG
Journal of Third Military Medical University 2001;23(4):451-453
Objective To investigate the actions of extra cellular medium in growth and differentiation of hair follicle and to look for growth adjusting factors for dermal papilla cells (DPC). Methods Dermal papilla cells were isolated and cultivated with two steps method and the cells were identified by immunohistochemical staining for actin. Influence was examined on the adhesion and growth of dermal papilla cells by chondroitin sulfate A, chondroitin sulfate C and heparin sulfate. Results Two steps method of enzyme digestion for isolating and cultivating dermal papilla cells was an efficient method and large amount of dermal papilla of high purity were harvested with this method. The method is very simple and easy to manege with. Increased adhesion and growth of dermal papilla cells were observed in specimen treated with chondroitin A and heparin sulfate. No significant effects was observed in the cells treated with chondroit in sulfate C. Conclusion Some extra cellular medium can regulate the adhesion and growth of dermal papilla cells and therefore influence the growth and development of hair follicle.