1.Clinical observation on obesity and hyperlipidemia of liver qi stagnation and spleen deficiency pattern in female patients treated with combined therapy of acupuncture and tapping method.
Bo WU ; Zhi-Cheng LIU ; Bin XU
Chinese Acupuncture & Moxibustion 2014;34(12):1151-1155
OBJECTIVETo explore the efficacy and effect mechanism of the combined therapy of acupuncture and tapping method in the treatment of obesity and hyperlipidemia of liver qi stagnation and spleen deficiency pattern in the patients.
METHODSOne hundred and four female patients were randomized into a combined therapy of acupuncture and tapping (combined therapy group) group method and an acupuncture group, 52 cases in each group. In the acupuncture group, acupuncture was applied to Qimen (LR 14), Taichong (LR 3), Zhangmen (LR 13), Taibai (SP 3), Zusanli (ST 36), Geshu (BL 17), Ganshu (BL 18), Pishu (BL 20), etc. In the combined therapy group, on the basis of acupuncture treatment, the tapping method with plum blossom needle was used at each acupoint. The treatment was given once every two days, continuously for 3 months in the two groups. The indices were observed, including the obesity indices, such as body mass, body mass index (BMI), body fat percentage (F%) and obesity degree (A); the blood lipid levels such as total cholesterol (TC), triglyceride (TG), low density lipoprotein (LDL) and high density lipoprotein (HDL); the fat-islet axie relevant indices such as fasting plasma glucose (FBS), fasting leptin (FLP), fasting insulin (FINS), insulin sensitive index (ISI), insulin resistance in- dex (Homa IR), insulin secretion index (Homa-β) and autonomic nerve function index (Y value) before and after treatment in the patients of two groups. The efficacy was compared between the two groups.
RESULTSThe total effective rates were 96.2% (50/52) and 84.6% (44/52) in the combined therapy group and the acupuncture group respectively, without significant difference in comparison (P > 0.05). Obesity indices, blood lipid indices, fat-islet axie relevant indices and autonomic nerve function indices were all improved after treatment as compared with those before treatment in the two groups (P < 0.01, P < 0.05), and the improvements in the combined therapy group were much more significant (P < 0.01, P < 0.05).
CONCLUSIONThe combined therapy of acupuncture and tapping method achieves the double effects of weight loss and lipid loss in the treatment of obesity combined with hyperlipidemia. The effect mechanism is possibly related to the positive regulations of blood glucose, lipid metabolism and fat-islet axie in the patients.
Acupuncture Points ; Acupuncture Therapy ; Adult ; Blood Glucose ; metabolism ; Female ; Humans ; Hyperlipidemias ; metabolism ; physiopathology ; therapy ; Insulin ; metabolism ; Leptin ; metabolism ; Liver ; physiopathology ; Middle Aged ; Obesity ; metabolism ; physiopathology ; therapy ; Qi ; Spleen ; physiopathology ; Treatment Outcome ; Triglycerides ; metabolism ; Young Adult
2.Effect and mechanisms of tetrahydroxystilbene glucoside on neuron proliferation in the hippocampus of epileptic rats
Juansong WU ; Xiumei CHENG ; Bin LUO
Chinese Journal of Comparative Medicine 2014;(10):63-66
Objective To explore the influence of tetrahydroxystilbene glucoside ( TSG ) on the neuron proliferation in epileptic rats and the related mechanisms.Methods 54 healthy SD male rats were randomly divided into three groups: sham-operated group, epilepsy group and epilepsy with TSG treatment group.The epilepsy group was established by stereotactic brain trace injection with kainic acid ( KA ) . TSG solution ( 3 mg/kg ) was injected intraperitoneally at 6 hours after the epilepsy group established, and then q.d.for consecutive 42 days.The sham-operated group and epilepsy group were injected with normal saline.The influence of TSG on cell proliferation of rat hippocampal dentate gyrus BrdU-positive granular cells was observed by immunohistochemistry.Results Compare with the epilepsy group, the amount of glial fibrillary acid protein ( GFAP)-positive astrocytes was significantly reduced and dentate gyrus BrdU-positive cells were significantly increased in the TSG group ( P <0.01 ) .Conclusions Tetrahydroxystilbene glucoside ( TSG) promotes neurogenesis of neural stem cells and neurons, and inhibits the growth of hippocampal dentate gyrus astrocytes in epilepsy rats.
3.The significance of proteomics in the discovery of hepatocellular carcinoma biomarker
Cheng WU ; Bin SHI ; Liang ZHU
China Oncology 2006;0(12):-
Proteomics was be widely used in different kinds of diseases recently.The role of proteomics has also expanded from comparative proteomic research to the analysis of function of proteins and interaction of proteins.Our article summarized specially that the role of proteomics may play in the discovery of hepatocellular carcinoma biomarker in the recent years.
4.Research advances on second primary malignancies of oral cavity following radiotherapy for nasopharyngeal carcinoma
Nan ZHAO ; Tong WU ; Bin CHENG
Journal of International Oncology 2016;43(2):145-147
Radiotherapy is the primary treatment modality for nasopharyngeal carcinoma(NPC) which can effectively control the disease.Oral cavity,anatomically near nasopharyngeal region is the main area for the occurrence of complication of radiotherapy.Second primary malignancy (SPM) in oral cavity is an important factor interferencing NPC patients survival rate.The etiology of oral SPM is unclear and,the prognosis is poor.The research of it is still in exploration.
5.Optimization of the Formulation and Technology of Compound Bovis Calculus Sativus Gel by Orthogonal Test
Lu CHENG ; Zhilong SONG ; Xin XIONG ; Bin WU
China Pharmacy 2016;27(10):1396-1399
OBJECTIVE:To optimize the preparation technology of Compound bovis calculus sativus gel. METHODS:The ul-trasonic emulsifying technology was optimized by orthogonal test using ultrasonic power,ratio of ultrasonic time to interval time, total ultrasonic time as factors,using centrifugal stability constant(KE)as index.Ultrasonic emulsifying method was applied to pre-pare O/W emulsions using paeonol,berberine hydrochloride and eucalyptus oil;then calculus bovis sativus powder was added into O/W emulsions,and then mixed with carbomer(940)gel matrix to prepare gel. The formulation of gel was optimized by orthogo-nal test with the amount of carbomer (940),glycerool and triethanolamine as factors,using compactibility score,comprehensive score of release rate in vitro as index. Validation test,stability test and content determination of bilirubin were conducted for gel pre-pared by optimized technology. RESULTS:The optimal ultrasonic emulsifying technology was as follows as ultrasonic power 450 W,ratio of ultrasonic time to interval time 2:1,and total ultrasonic time 5 min. The optimal formulation of gel was as follows as carbomer(940)0.5%,glycerool 15%,triethanolamine 0.20%(g/100 g). The average of KE of validation test and average compre-hensive score were 0.175 and 98.67(RSD<2%,n=3);the appearance of the preparation had no obvious change in stability test, and average percentage of bilirubin in labeled content was 100.8%. CONCLUSIONS:The optimal formulation and preparation tech-nology of gel is feasible,and the prepared gel is stable and controllable in quality.
6.Effects of silencing MALAT1 on proliferation and apoptosis in HepG2 cells induced by Melittin
Bin ZHAO ; Yuting WU ; Cheng HUANG ; Xiongwen LYU ; Jun LI
Chinese Pharmacological Bulletin 2016;(2):211-215,216
Aim To investigate the effects of silencing MALAT1 gene on cell proliferation inhibition and apop-tosis induced by Melittin in human hepatocellular car-cinoma HepG2 cells. Methods The inhibitory rate of cell proliferation treated with Melittin in HepG2 cells was examined by MTT assay. Apoptotic rate was detec-ted by flow cytometry. The MALAT1 expression level in HepG2 cells was measured by qPCR. Specific siR-NAs were utilized to silence MALAT1 expression. The rates of cell proliferation inhibition and apoptosis in HepG2 cells treated with siRNA and Melittin were compared with those of Melittin alone. Results Melit-tin significantly suppressed the growth of HepG2 and induced cell apoptosis in a dose-dependent manner. Compared with normal liver cell lines, MALAT1 was highly expressed in HepG2 cells ( P<0. 05 ) . The ex-pression of MALAT1 in HepG2 cells was inhibited by Melittin, and the inhibitory rate increased with the in-crease of concentration. The rates of cell proliferation inhibition and apoptosis in HepG2 cells treated with siRNA and Melittin were significantly higher than those treated merely with Melittin. Conclusion Melittin can reduce the expression of MALAT1 and silencing MALAT1 can effectively promote proliferation inhibi-tion and apoptosis in HepG2 cells induced by Melittin.
7.Effect of peritoneal dialysis fluids on the expression of TLR2 and TLR4 on peritoneal mesothelial cells
Jun WU ; Min HE ; Jian ZHANG ; Wenfei HE ; Bin CHENG ;
Chongqing Medicine 2016;(2):156-158,163
Objective To investigate the effect of glucose-based peritoneal dialysis fluids and icodextrin-based peritoneal dial-ysis fluids on the expression of TLR2 and TLR4 on huamn peritoneal mesothelial cells .Methods Human peritoneal mesothelial cell line 5 - 10 generations(HMrSV5) was cultured in DMEM /F12 medium supplemented with 10% (v/v) fetal calf serum (FCS) .Cell viability and cell proliferation were assessed using M TT method .The experiment were divided into 5 different groups :group A (control group) ,1 .5% dextrose group ,2 .5% dextrose group ,4 .25% dextrose group and 7 .5% Lcodextrin group .Icodextrin group (aikau dextrin) ,TLR2 and TLR4 expression were detected by Western blot .Results Treatment with different concentrations of glucose-based peritoneal dialysis fluids for 24 h did not affect the expression of TLR2 and TLR4 protein .In addition ,after stimula-tion for 48 h ,1 .5% dextrose ,2 .5% dextrose ,4 .25% dextrose decreased TLR2 expression by (5 .5 ± 2 .8)% ,(31 .4 ± 7 .5)% , (54 .9 ± 1 .9)% respectively ,TLR4 expression by (32 .9 ± 17 .6)% ,(47 .7 ± 13 .5)% ,(66 .4 ± 13 .5)% respectively .Stimulation for 72 h ,decreased TLR2 expression by (29 .4 ± 14 .7)% ,(38 .9 ± 9 .9)% ,(63 .5 ± 16 .5)% respectively ,TLR4 expression by(59 .5 ± 16 .8)% ,(63 .1 ± 9 .5)% ,(79 .2 ± 14 .0)% respectively .There was no significant change in TLR2 and TLR4 protein expression on 7 .5% icodextrin group .Conclusion Glucose-based peritoneal dialysis fluids ,but not icodextrin-based peritoneal dialysis fluids downregulates expression of TLR2 and TLR4 by HM rSV5 .
8.Gallbladder Abnormal Changes Caused by Liver Parenchymal Diseases Versus Inflammatory Cholecystitis: Differential Diagnosis by Multi-Detector Row Spiral CT
Yinghua WU ; Bin SONG ; Xiaohua LUO ; Yan CHENG ; Juan XU ;
Chinese Journal of Bases and Clinics in General Surgery 2004;0(01):-
Objective By using multi detector row spiral CT (MDCT) to investigate the CT imaging findings of gallbladder abnormalities caused by hepatic parenchymal diseases and those of inflammatory cholecystitis. Methods CT and clinical data of 80 patients with gallbladder abnormalities were retrospectively reviewed. Fifty patients were in hepatic disease group, including 20 chronic hepatitis, 25 liver cirrhosis, and 5 cirrhosis with hepatocellular carcinoma. Thirty patients were in inflammatory group, including 19 chronic cholecystitis, 6 acute cholecystitis, 3 cholecystitis with acute pancreatitis, 1 gangrenous cholecystitis, and 1 xanthogranulomatous cholecystitis. All patients underwent MDCT plain scan and contrast enhanced dual phase scanning of upper abdomen. Results In hepatic disease group, 48 cases had evenly thickened gallbladder wall (96%) with mean thickness of (3.67?0.49) mm; 38 cases had clear gallbladder outlines (76%); 38 cases had gallbladder wall enhancement of various degree (76%); 14 cases had gallbladder bed edema and localized non dependant pericholecystic fluid collection (28%). In inflammatory cholecystitis group, 28 cases had obscuring gallbladder outlines (93%) ; 26 cases had gallbladder wall evenly thickened (87%), 4 cases showed unevenly thicked wall (13%), the mean thickness being (4.54?1.14) mm; 30 cases had inhomogenous enhancement of the gallbladder wall (100%); 9 cases had high attenuation bile (30%); 4 cases had dependant pericholecystic fluid collection (13%); 5 cases had transient enhancement of adjacent hepatic bed in arterial phase (17%); micro abscess and gas in the gallbladder wall was observed in 1 case respectively. Conclusion MDCT can offer imaging findings useful for differentiating abnormal gallbladder changes caused by hepatic parenchymal diseases from those due to inflammatory cholecystitis.
9.Clinical evaluation of 2 kinds of osteocutaneous flap in the treatment of mandibular osteoradionecrosis
Zhiwen BIN ; Cheng WANG ; Xiaolin WU ; Jinsong HOU
Journal of Practical Stomatology 2015;(3):412-416
Objective:To evaluate the clinical outcomes of 2 kinds of osteocutaneous flap in the treatment of mandibular osteoradione-crosis.Methods:35 cases with mandibular osteoradionecrosis were treated by partial mandibulectomy and bone graft according to de-fect size and patients'requirements.The defects in 7 patients were reconstructed with iliac osteocutaneous flap and 28 with fibular os-teocutaneous flap.All flaps and wounds were monitored regularly.Results:One flap with venin crisis was observed in the patients treated with iliac osteocutaneous flap,its skin island was failed but the bone graft was survived.In the fibular osteocutaneous flap group,3 flaps with vein crisis were observed.2 of them were failed and 1 was rescued after second surgery.The most common compli-cations were infection,delayed wound healing and scar.The appearance and function were all satisfied and limitation of mouth opening was improved after surgery.Conclusion:Both of fibular osteocutaneous flap and iliac osteocutaneous flap can be applied in the defect reconstruction of patients with mandibular osteoradionecrosis.Fibular osteocutaneous flap is a good choice for huge mandibular defect and iliac osteocutaneous flap seems more esthetical.
10.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.