OBJECTIVE: To report on a rare case of Neurofibromatosis type 2 (NF2) manifesting as oculomotor nerve palsy and explore its genetic basis. METHODS: A patient with NF2 who had presented at Beijing Ditan Hospital Affiliated to Capital Medical University on July 10, 2021 was selected as the study subject. Cranial and spinal cord magnetic resonance imaging (MRI) was carried out on the patient and his parents. Peripheral blood samples were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing. RESULTS: MRI revealed bilateral vestibular Schwannomas, bilateral cavernous sinus meningiomas, popliteal neurogenic tumors, and multiple subcutaneous nodules in the patient. DNA sequencing revealed that he has harbored a de novo nonsense variant of the NF2 gene, namely c.757A>T, which has replaced a codon (AAG) encoding lysine (K) at position 253 with a stop codon (TAG). This has resulted in removal of the Merlin protein encoded by the NF2 gene from position 253 onwards. The variant was not found in public databases. Bioinformatic analysis suggested that the corresponding amino acid is highly conserved. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was rated as pathogenic (PVS1+PS2+PM2_Supporting+PP3+PP4). CONCLUSION The heterozygous nonsense variant c.757A>T (p.K253*) of the NF2 gene probably underlay the disease in this patient with an early onset, atypical but severe phenotype.
Male ; Humans ; Neurofibromatosis 2/genetics* ; Genes, Neurofibromatosis 2 ; Oculomotor Nerve Diseases/genetics* ; Computational Biology ; Genomics ; Mutation

Cochlear Implantation ; Genes, Neurofibromatosis 2 ; Humans ; Neurofibromatosis 2/surgery* ; Neuroma, Acoustic/surgery* ; Sequence Deletion

BACKGROUND: We previously reported the frequent neurofibromatosis 2 (NF2) gene mutations in anaplastic thyroid cancers in association with the BRAF V600E mutation. We aimed to investigate the role of NF2 in thyroid cancer with BRAF mutation. METHODS: To identify the function of NF2 in thyroid cancers, we investigated the changes in cell proliferation, colon formation, migration and invasion of thyroid cancer cells (8505C, BHT101, and KTC-1) with BRAF V600E mutation after overexpression and knock-down of NF2. We also examined how cell proliferation changed when NF2 was mutagenized. Human NF2 expression in papillary thyroid carcinoma (PTC) was analyzed using the The Cancer Genome Atlas (TCGA) data. RESULTS: First, NF2 was overexpressed in 8505C and KTC-1 cells. Compared to control, NF2 overexpressed group of both thyroid cancer cells showed significant inhibition in cell proliferation and colony formation. These results were also confirmed by cell migration and invasion assay. After knock-down of NF2 in 8505C cells, there were no significant changes in cell proliferation and colony formation, compared with the control group. However, after mutagenized S288* and Q470* sites of NF2 gene, the cell proliferation increased compared to NF2 overexpression group. In the analysis of TCGA data, the mRNA expression of NF2 was significantly decreased in PTCs with lateral cervical lymph node (LN) metastasis compared with PTCs without LN metastasis. CONCLUSION: Our study suggests that NF2 might play a role as a tumor suppressor in thyroid cancer with BRAF mutation. More studies are needed to elucidate the mechanism how NF2 acts in thyroid cancer with BRAF mutation.
Cell Movement ; Cell Proliferation ; Colon ; Genes, Neurofibromatosis 2 ; Genes, Tumor Suppressor ; Genome ; Humans ; Lymph Nodes ; Neoplasm Metastasis ; Neurofibromatosis 2 ; RNA, Messenger ; Thyroid Carcinoma, Anaplastic ; Thyroid Gland ; Thyroid Neoplasms

PURPOSE: Neurofibromatosis type 2 (NF2) is characterized by multiple tumors, including vestibular schwannoma (VS) and others affecting cranial and peripheral nerves. NF2 is caused by mutation of the NF2 gene. The mutation spectrum of NF2 has not been characterized in Korean patients. In the current study, the clinical and genetic characteristics of Korean NF2 patients were analyzed. MATERIALS AND METHODS: Twenty-five unrelated Korean families were enrolled according to the Manchester criteria. Genetic analysis was performed by direct sequencing and multiplex ligation-dependent probe amplification methods using genomic DNA from peripheral lymphocytes or tumor tissues. RESULTS: All patients had bilateral/unilateral VS and/or other cranial and peripheral nerve tumors. Two patients were familial cases and the other 24 patients were sporadic. Germline NF2 mutations were detected in peripheral lymphocytes from both familial cases, but only in 26.1% of the 23 sporadic families. Somatic mutations were also found in tumor tissues from two of the sporadic families. These somatic mutations were not found in peripheral lymphocytes. A total of 10 different mutations including 2 novel mutations were found in 40.0% of studied families. Five mutations (50.0%) were located in exon 6 of NF2, the FERM domain coding region. CONCLUSION: Family history was an important factor in identifying germline NF2 mutations. Further study is required to investigate whether exon 6 is a mutation hotspot in Korean NF2 patients and its correlation to phenotypic severity.
Clinical Coding ; DNA ; Exons ; Genes, Neurofibromatosis 2 ; Humans ; Korea ; Lymphocytes ; Multiplex Polymerase Chain Reaction ; Neurofibromatoses* ; Neurofibromatosis 2* ; Neuroma, Acoustic ; Peripheral Nerves ; Peripheral Nervous System Neoplasms

Mutations in the NF2 tumor suppressor gene cause neurofibromatosis type 2, an autosomal dominant inherited syndrome predisposed to the multiple tumors of the nervous system. Merlin, the NF2 gene product was reported to block Ras-mediated cell transformation and represses Ras-induced expression of cyclin D1. However, the potential mechanism underlying the anti-Ras function of merlin on the cyclin D1 is still unclear. In this study, we investigated whether merlin decreases Ha-ras-induced accumulation of cyclin D1 at the transcriptional level, and demonstrated that merlin suppressed Ras-induced cyclin D1 promoter activity mediated by the cyclic AMP-responsive element (CRE) in SK-N-BE (2) C neuroblastoma cells. Furthermore, we found that merlin attenuated active Ras and forskolin-induced CRE-driven promoter activity. These results suggest that the transcriptional repression of the cyclin D1 expression by merlin may contribute to the inhibition of Ras-induced cell proliferation
Cell Proliferation ; Cyclin D1* ; Cyclins* ; Genes, Tumor Suppressor ; Nervous System Neoplasms ; Neuroblastoma ; Neurofibromatosis 2 ; Neurofibromin 2* ; Repression, Psychology

Acoustic tumor is the most common tumor originating from cerebellopontine angle. Acoustic tumor is benign and main origin of this tumor is vestibular nerve. This tumor arises in Schwann cell (SC) and is encapsulated. Recently, the tumor is called vestibular schwannoma (VS). VS is classified to two type by epidemiology, sporadic form and neurofibromatosis type 2 (NF2). NF2 is autosomal dominant inherent disorder. This tumor is characterized bilateral VS, brain tumors such as meningioma and ependymoma, and spinal or cranial nerve schwannoma. Genetic studies suggested that NF2 is caused by abnormality or mutation of NF2 gene in chromosome 22q12. Both of them are known to develop the tumor by mutation of NF2 gene. Merlin is the cytoskeletal protein product of the NF2 tumor suppressor gene that mediates cell to cell contact information to regulate SC proliferation and survival. And merlin is highly homologous to ERM proteins. Merlin function is regulated by its conformation, adopting an inactive, growth permissive state following serine 518 (S518) phosphorylation. In NF2 patients, the precise mechanisms of developing the VS are unclear. But, the abnormalities of merlin are confirmed by many studies. And now, a lot of research about merlin function is progressing. In this study, the author would introduce about merlin (structure, function, molecular pathway, tumorigenesis and regulation) which leads to VS and molecular studies about merlin, and suggest the future direction of research.
Brain Neoplasms ; Cell Transformation, Neoplastic ; Cerebellopontine Angle ; Cranial Nerves ; Ependymoma ; Genes, Neurofibromatosis 2 ; Genes, Tumor Suppressor ; Humans ; Meningioma ; Neurilemmoma ; Neurofibromatosis 2 ; Neurofibromin 2 ; Neuroma, Acoustic ; Phosphorylation ; Proteins ; Serine ; Vestibular Nerve

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

OBJECTIVETo investigate the impact of S518 phosphorylation in Merlin on the interaction with CD44 in vestibular schwannoma and the tumor growth.

METHODSThirty-five samples of vestibular schwannoma were identified by pathology. Immunohistopathology and western blot were employed to analyze the expression and localization of S518 phosphorylated Merlin in the tumor tissues. Nerve tissues that were collected during other surgical operation were used as control. The expression level of S518 phosphorylated Merlin was compared with clinical stages, tumor size, clinical course and cystic degeneration. Immunoprecipitation was used to evaluate the impact of S518 phosphorylation in Merlin on the interaction with CD44.

RESULTSIn vestibular schwannoma, Merlin was phosphorylated at S518 and demonstrated perinuclear localization. The S518 phosphorylation level was much lower in the normal control nerve tissues than that in vestibular schwannoma tissues. There was no correlation between the phosphorylation level on Merlin and clinical stages, tumor size, clinical course and cystic degeneration. The S518 phosphorylated Merlin bound CD44 was higher than wild-type Merlin bound CD44 in vestibular schwannoma tissues.

CONCLUSIONSThe affinity of Merlin to CD44 was increased after phosphorylation at S518. Different cellular biological results might be triggered through binding to wild type Merlin and S518 phosphorylated Merlin.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Hyaluronan Receptors ; genetics ; metabolism ; Male ; Middle Aged ; Neoplasm Staging ; Neurofibromin 2 ; genetics ; metabolism ; Neuroma, Acoustic ; genetics ; metabolism ; pathology ; Phosphorylation

OBJECTIVE: To determine the expression and clinical significance of Merlin protein in non-small cell lung cancer (NSCLC). METHODS: The expression of Merlin protein in 45 cases of NSCLC and adjacent tissue of NSCLC and normal lung tissue was checked by immunohistochemistry. The relation between the expression of Merlin protein and the multiple factors of pathological type, gender, P-TNM stage, differentiation and lymph node metastasis was analyzed. RESULTS: The expression rates of Merlin protein in NSCLC and normal lung tissue sections were 73.33% and 15.56%, respectively (P<0.05). The expression of Merlin protein was not associated with the pathological type, gender, P-TNM stage, differentiation and lymph node metastasis (P>0.05). CONCLUSION Merlin protein might contribute to the initiation of metastasis of NSCLC.
Adult ; Aged ; Carcinoma, Non-Small-Cell Lung ; metabolism ; pathology ; Female ; Genes, Neurofibromatosis 2 ; physiology ; Humans ; Lung Neoplasms ; metabolism ; pathology ; Male ; Middle Aged ; Neoplasm Metastasis ; Neurofibromin 2 ; metabolism

PURPOSE: Neurofibromatosis 2(NF2) is an autosomal dominant disease characterized by development of bilateral acoustic neuroma and various central nervous system tumors such as meningiomas, ependymomas, and schwannomas. Recent cloning of the gene responsible for NF2, the NF2 gene, permits the presymptomatic genetic diagnosis of affected individuals by direct analysis of the gene. This paper was intended to identify germline mutations in Korean NF2 patients. MATERIALS AND METHODS: We collected blood samples from 15 clinically diagnosed NF2 patients treated at the Department of Neurosurgery, Seoul National University Hospital. Purified genomic DNA samples were analyzed for mutations of the NF2 gene by using polymerase chain reaction(PCR)-single strand conformation polymorphism(SSCP) method followed by direct DNA sequencing. RESULTS: We were able to identify germline mutation of the NF2 gene in one patient. The mutation identified was 1 base pair deletion(A) at codon 318, resulting in premature stop codon due to frameshift. CONCLUSION: Identification of the germline mutation in NF2 gene should enable us to test all individual family members at risk to determine whether or not they carry the mutant NF2 gene.
Base Pairing ; Central Nervous System Neoplasms ; Clone Cells ; Cloning, Organism ; Codon ; Codon, Nonsense ; Diagnosis ; DNA ; Ependymoma ; Genes, Neurofibromatosis 2* ; Germ-Line Mutation* ; Humans ; Meningioma ; Neurilemmoma ; Neurofibromatoses* ; Neurofibromatosis 2* ; Neuroma, Acoustic ; Neurosurgery ; Seoul ; Sequence Analysis, DNA