1.Advanced techniques of southern blot hybridization.
In Jang CHOI ; Yong Wook JUNG ; Dae Kwang KIM ; Sung Ik CHANG ; Ihn Hwan LEE
Korean Journal of Anatomy 1991;24(2):219-225
No abstract available.
Blotting, Southern*
2.Diagnosis of human papillomavirus in cervical neoplasia by using southern blot hybridization technique and ViraPap@ HPV DNA detection kit.
Yeon PARK ; Min Soo KIM ; Kee Mook CHUNG ; Jae Hoon CHUNG ; Kyang Hyuk KIM
Korean Journal of Obstetrics and Gynecology 1992;35(10):1501-1508
No abstract available.
Blotting, Southern*
;
Diagnosis*
;
DNA*
;
Humans*
3.Detection of Human Papillomavirus DNA in Condylomata Acuminata Patients using Molecular Hybridization.
Kyoung Chan PARK ; Sang Hak LEE ; Yoo Shin LEE ; Young Kee KIM ; Heung Bae PARK ; Jeong Seon SEO
Korean Journal of Dermatology 1989;27(6):660-665
Condylomata acuminata are benign tumors which are mostly venereally transmitted. Common sites were coronal sulcus, perisnal area and prepuce. Among 28 patients, 21 acuminate lesions and 10 papular lesions were found. Twenty eight human genital warts in Korean were analysed by Southern blot hybridization. Sequences related to HPV6/11 are found in 89.3%(25/28) of the condylomata. HPV16 DNA was not found at sll. Subtype of HPV was determined by the restriction pattern of DNA cleaved with PstI restriction enzyme in 7 cases. Six cases of HPV6a and one case of HPV6c are found. The above results suggest that most of condylomata acuminata are caused by HPV6 and HPV11 in Korea.
Blotting, Southern
;
Condylomata Acuminata*
;
DNA*
;
Humans*
;
Korea
4.The Efficient Transformation of Pleurotus ostreatus using REMI Method.
Joong Ho JOH ; Beom Gi KIM ; Kyo Sun CHU ; Won Sik KONG ; Young Bok YOO ; Chang Soo LEE
Mycobiology 2003;31(1):32-35
Restriction enzyme-mediated integration (REMI) was used to transform uracil auxotrophs of Pleurotus ostreatus to prototrophy. When protoplasts of Pleurotus ostreatus were treated by the reaction mixture containing 10 units of BamHI, the frequency of REMI was about 64 transformants per 1 microg of DNA. This efficiency was increased by 14.2 times compared with that of the conventional PEG transformation. The optimal condition for REMI of P. ostreatus was achieved when 1 microg of linearized pTRura3-2 DNA was added into 1x10(7) protoplasts along with 10 units BamHI. Southern blot analysis revealed that about 50% of transformants examined were caused by REMI event and 30% carried single copy insertion at the genome. This suggested that the REMI method might be a useful tool for efficient transformation and tagging mutagenesis of P. ostreatus.
Blotting, Southern
;
DNA
;
Genome
;
Mutagenesis
;
Pleurotus*
;
Protoplasts
;
Uracil
5.Caveolin-1 is involved in high glucose accelerated human glomerular mesangial cell senescence.
The Korean Journal of Internal Medicine 2017;32(5):883-889
BACKGROUND/AIMS:: We demonstrated the role of caveolin-1 involved in high glucose (HG)-induced glomerular mesangial cells (GMCs) senescence. METHODS:: HG was used to stimulate GMCs. The telomere lengths were analyzed by Southern blot. β-Galactosidase staining was determined. The expressions of caveolin-1 and P53 proteins were determined by Western blot. RESULTS:: Treatment with high concentrations of glucose induced GMC senescence accompanied by shortened telomere length and increase of β-galactosidase staining as well as P53 protein, which was abrogated after application of caveolin-1-siRNA. CONCLUSIONS:: This study proved that HG induced cell senescence in GMCs. The caveolin-1 is involved in HG-induced mesangial cell senescence, and blocking caveolin-1 significantly reduced cell senescence. The effect of caveolin-1 is mediated by P53 pathway.
Aging*
;
Blotting, Southern
;
Blotting, Western
;
Caveolin 1*
;
Cell Aging
;
Glucose*
;
Humans*
;
Mesangial Cells*
;
Telomere
6.Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR).
Sae Jin JEON ; Ki San KIM ; Won Ki BAEK ; Sung Il SEO ; Min Ho SEO
Journal of the Korean Ophthalmological Society 1996;37(12):1996-2002
The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.
Blotting, Southern
;
DNA
;
Electrophoresis, Agar Gel
;
Herpes Simplex*
;
Humans
;
Keratitis
;
Keratitis, Herpetic
;
Polymerase Chain Reaction
;
Simplexvirus*
7.Study on development of DNA probe for identification of Prevotella intermedia G8-9K-3.
Jong Sung BAK ; Se Hoon KIM ; Dong Kie KIM ; Jin Hyo SEONG ; Byung Ock KIM ; Mi Kwang KIM ; Joong Ki KOOK
The Journal of the Korean Academy of Periodontology 2002;32(2):281-290
The purpose of this study is to develop species-specific DNA probe for detection and identification of Prevotella intermedia (P. intermedia) G8-9K-3. This study procedure includes (1) whole-genomic DNA extraction of P. intermedia G8-9K-3 (2) construction of the genomic DNA library, (3) screening of strain-specific DNA probe by reverse dot hybridization, (4) confirmation of strain-specific DNA probe by Southern blot hybridization, (5) determination of nucleotide sequences of strain-specific DNA probe. Twenty-eight recombinant plasmids containing Hind III-digested DNA fragments of P. intermedia G8-9K-3 were obtained. Reverse dot Hybridization and Southern blot analysis data showed that one of them, Pig3, could be P. intermedia G8-9K-3-specific DNA probe. This datum indicates that this Pig3 DNA probe could be useful in detection and identification of the P. intermedia G8-9K-3 strain.
Base Sequence
;
Blotting, Southern
;
DNA*
;
Gene Library
;
Mass Screening
;
Plasmids
;
Prevotella intermedia*
;
Prevotella*
8.A novel PCR primers HPU185 and HPL826 based on 16S rRNA gene for detection of Helicobacter pylori.
Jong Bae KIM ; Geun Hee KIM ; Hong KIM ; Hyun Seok JIN ; Young Sam KIM ; Soo Hyun HA ; Dong Ki LEE
Journal of the Korean Society for Microbiology 2000;35(4):283-288
The PCR primer set JW21-JW22 of Weiss et al. (19), which was reported to amplify a 139-bp fragment of the 16S rRNA gene of Helicobacter pylori, has been recently used for the detection of H. pylori in clinical specimens. However, when we applied JW21-JW22 PCR to other members of the genus Helicobacter and unrelated microorganisms, all of these bacteria produced a 139-bp PCR product. Therefore, we designed a novel primer set, HPU185-HPL826, which produced a 642-bp amplicon of the 16S rRNA gene of H. pylori. Then we further examined the specificity of the novel PCR assay using Southern blot hybridization with an internal probe, HPP225. The PCR assay described in this study was shown to be highly sensitive and specific only to the H. pylori 16S rRNA gene sequences.
Bacteria
;
Blotting, Southern
;
Genes, rRNA*
;
Helicobacter pylori*
;
Helicobacter*
;
Polymerase Chain Reaction*
;
Sensitivity and Specificity
9.Detection of Glycoproteins (B and D) and Ttymidine Kinase Genes of Herpes simplex virus Type 2 Strain G.
Hyun KANG ; Jong Kuk PARK ; Hong Sun UH ; Soo Young KIM ; Hyung Hoan LEE
Journal of the Korean Society of Virology 1999;29(2):99-105
BamHI restriction patters and genomic library of Herpes simplex virus type 2 (HSV-2) stram G were constructed, and locations of the glycoproteins gB and gD, and it genes on the fragments were detected by Southern blot analysis. HISV-2 genomic DNAs were cleaved into twenty-seven fragments by BamHI enzyme in the range of 0.72 to 15.08 (total 150.44 kb), which were cloned into the BamHI site of pBluescript SK(+) to construct genome library of the HSV-2. The library was named by the order of the fragment size from smallest one to largest one. HSV-2 glycoprotein gD gene was located in PHLA2-21 and PHLA2-22 recombinant plasmids, gB gene in PHLA2-24 plasmic, and it gene in PHLA2-11 clone by Southern blot analysis.
Blotting, Southern
;
Clone Cells
;
DNA
;
Genomic Library
;
Glycoproteins*
;
Herpes Simplex*
;
Herpesvirus 2, Human*
;
Phosphotransferases*
;
Plasmids
;
Simplexvirus*
10.Detection of Glycoproteins (B and D) and Ttymidine Kinase Genes of Herpes simplex virus Type 2 Strain G.
Hyun KANG ; Jong Kuk PARK ; Hong Sun UH ; Soo Young KIM ; Hyung Hoan LEE
Journal of the Korean Society of Virology 1999;29(2):99-105
BamHI restriction patters and genomic library of Herpes simplex virus type 2 (HSV-2) stram G were constructed, and locations of the glycoproteins gB and gD, and it genes on the fragments were detected by Southern blot analysis. HISV-2 genomic DNAs were cleaved into twenty-seven fragments by BamHI enzyme in the range of 0.72 to 15.08 (total 150.44 kb), which were cloned into the BamHI site of pBluescript SK(+) to construct genome library of the HSV-2. The library was named by the order of the fragment size from smallest one to largest one. HSV-2 glycoprotein gD gene was located in PHLA2-21 and PHLA2-22 recombinant plasmids, gB gene in PHLA2-24 plasmic, and it gene in PHLA2-11 clone by Southern blot analysis.
Blotting, Southern
;
Clone Cells
;
DNA
;
Genomic Library
;
Glycoproteins*
;
Herpes Simplex*
;
Herpesvirus 2, Human*
;
Phosphotransferases*
;
Plasmids
;
Simplexvirus*