No abstract available.
Blotting, Southern*

No abstract available.
Blotting, Southern* ; Diagnosis* ; DNA* ; Humans*

Condylomata acuminata are benign tumors which are mostly venereally transmitted. Common sites were coronal sulcus, perisnal area and prepuce. Among 28 patients, 21 acuminate lesions and 10 papular lesions were found. Twenty eight human genital warts in Korean were analysed by Southern blot hybridization. Sequences related to HPV6/11 are found in 89.3%(25/28) of the condylomata. HPV16 DNA was not found at sll. Subtype of HPV was determined by the restriction pattern of DNA cleaved with PstI restriction enzyme in 7 cases. Six cases of HPV6a and one case of HPV6c are found. The above results suggest that most of condylomata acuminata are caused by HPV6 and HPV11 in Korea.
Blotting, Southern ; Condylomata Acuminata* ; DNA* ; Humans* ; Korea

Restriction enzyme-mediated integration (REMI) was used to transform uracil auxotrophs of Pleurotus ostreatus to prototrophy. When protoplasts of Pleurotus ostreatus were treated by the reaction mixture containing 10 units of BamHI, the frequency of REMI was about 64 transformants per 1 microg of DNA. This efficiency was increased by 14.2 times compared with that of the conventional PEG transformation. The optimal condition for REMI of P. ostreatus was achieved when 1 microg of linearized pTRura3-2 DNA was added into 1x10(7) protoplasts along with 10 units BamHI. Southern blot analysis revealed that about 50% of transformants examined were caused by REMI event and 30% carried single copy insertion at the genome. This suggested that the REMI method might be a useful tool for efficient transformation and tagging mutagenesis of P. ostreatus.
Blotting, Southern ; DNA ; Genome ; Mutagenesis ; Pleurotus* ; Protoplasts ; Uracil

BACKGROUND/AIMS:: We demonstrated the role of caveolin-1 involved in high glucose (HG)-induced glomerular mesangial cells (GMCs) senescence. METHODS:: HG was used to stimulate GMCs. The telomere lengths were analyzed by Southern blot. β-Galactosidase staining was determined. The expressions of caveolin-1 and P53 proteins were determined by Western blot. RESULTS:: Treatment with high concentrations of glucose induced GMC senescence accompanied by shortened telomere length and increase of β-galactosidase staining as well as P53 protein, which was abrogated after application of caveolin-1-siRNA. CONCLUSIONS:: This study proved that HG induced cell senescence in GMCs. The caveolin-1 is involved in HG-induced mesangial cell senescence, and blocking caveolin-1 significantly reduced cell senescence. The effect of caveolin-1 is mediated by P53 pathway.
Aging* ; Blotting, Southern ; Blotting, Western ; Caveolin 1* ; Cell Aging ; Glucose* ; Humans* ; Mesangial Cells* ; Telomere

In order to elucidate the c-myc and c-Ha-ras oncogenes expressions in human bladder cancers. we examined twelve bladder cancer tissues. two normal bladder tissues and two blood specimens with Southern. Northern and Slot blot hybridizations. In Southern blot all of the specimens showed 14 kilobase(Kb) c-myc band and 6.6kb c-Ha-ras band. No significant amplifications were observed in the levels of c-myc and c-Ha-ras DNA in cancer tissues. In Northern and slot blot, four bladder cancer tissues showed increased expression of c-myc RNA. No significant differences were observed in the levels of c-Ha-ras RNA expression between cancer tissues and normals. In conclusion. these findings support that quantitative increase in c-myc expression plays its role in the development of bladder cancers. Further studies about c-Ha-ras point mutation analysis and P21 ras protein analysis should be done to identify the role or c-Ha-ras in bladder tumorigenesis.
Blotting, Southern ; Carcinogenesis ; DNA ; Humans* ; Oncogenes* ; Point Mutation ; RNA ; Urinary Bladder Neoplasms* ; Urinary Bladder*

Genomic DNAs were extracted from cervical lavages of 49 patients with cervical cancer. Dot and Southern blot hybridization were performed using the P-labeled HFV DNA probes to find high risk HPV(type 16 and 18) infection that is known as the mast prevalent pathogenic factor in cervical cancer. Furthermore, genornic DNAs purified frnm cervical cancer tissues were studied in 8 out of 49 patients allowing us to convince the results from cervical lavages. The results were as follaws: 1. Dot blot analysis were used to examine the sensitivity and specificity of hybridization condition and HPV-DNA probes. Fasitive signals were obtained even at the level of 10pg for HPV DNA, but no signals could he detected at the level of as much as 400pg for salmon sperm DNA. 2. Dot blot of DNAs from cervircal lavages showed positive signals in 32.7%(16/49) with HPV type 16 probe and 20.4% (10/49)and one mixed infection was found. 3. When the DNAs from cervircal lavages of 49 patients were classified according to the clinical stage of cervical cancer, the infection rates of HPV type 16 and 18 were 50% (2/4) in CIN, 80% (4/5) in stage I, 64. 2% (9/14) in stage I b, 45% (9I20) in stage II and 16. 7% (1/6) in stage Ill and K respectively. The occurrenr,e of HPV type 16 and 18 seemed to be the highest in the cervical cancer stage 1 (68.4%(13/19). 4. Experiments perfornecl with genomic DNAs from 8 cancer tissues showed similar results compared to those of cervical lavages, but the intensity of positive signals was stronger. 5. Genomic DNAs from 5 patients(3 cases from cervical lavages and 2 cases from cervical cancer tissues) which showed strong positive signals to the dot blot analysis were further examined by Southern blot hybridixation using HFV type 16 DNA probe. When DNAs were digested with Pst 1 restriction enzyme, the five characteristic frgmenta of BFV type 16(2.8, l.9, l.6, 1.0 and 0.5 kb long in length) were recognized in ell 5 cases, These results may suggest a direet relatianship between HPV type 16 & 18 infectioas considered as the most effective methods for HPV detectioe and typing. Mo1ecular biclogieal studies in the reserarch of HPV are expected to reveal and help us understand the pathogenesis of cervical cancer.
Blotting, Southern ; Coinfection ; DNA Probes ; DNA* ; Humans* ; Salmon ; Sensitivity and Specificity ; Spermatozoa ; Therapeutic Irrigation ; Uterine Cervical Neoplasms*

Herpes simplex virus(HSV) infection has long been considered as a cause of erythema multiform(EM), especially the recurrent type, although its exact role in the pathogenesis of herpes-associated erytherna multiforme(HAEM) is unknown. In this study, HSV DNA was detected in 8 of 29 cases of EM by the polymerase chain reaction(PCR) and in 19 of 29 cases by Southern blot hybridization with PCR products. In 4 cases of EM, we performed PCR & Southern blot hybridization in both lesional and normal skin. HSV DNA was found in 3 of 4 cases of lesional skin but not detected in normal skins by Southern blot hybridization with PCR products. These results confirm the presence of HSV DNA in lesions of HAEM and support the concept of and HSV-specific immune-mediated pathogenesis for this disease.
Blotting, Southern ; DNA ; Erythema Multiforme* ; Erythema* ; Heme ; Herpes Simplex* ; Polymerase Chain Reaction* ; Simplexvirus* ; Skin

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.
Blotting, Southern ; DNA ; Electrophoresis, Agar Gel ; Herpes Simplex* ; Humans ; Keratitis ; Keratitis, Herpetic ; Polymerase Chain Reaction ; Simplexvirus*

PURPOSE: Telomeres, special protein and tandem repeat DNA structure that cap the ends of linear eukaryotic chromosomes, are essential for chromosome structure and stability. Human telomeric DNA is known to shorten by 30~200 bp with each somatic cell division. However, the phase of telomere changes has not been studied extensively. METHODS: Telomere length was analyzed in the peripheral blood mononuclear cells (PBMCs) of 39 normal controls aged from newborn to 72 years by Southern blot hybridization using PharMingen's TeloQunatTM Telomere Length Assay Kit (Becton Dickinson Co.). RESULTS: The mean telomere length of the population was 9.68 kb (range, 5.65~14.40 kb). The length (kb) decreased with age (A) by the following regression: T=10.86 0.04 A (T=telomere length in kb; A=age in years) (r= 0.38; P=0.016). The mean telomere lengths according to age groups were: 10.26 kb for less than 15 years; 9.92 kb for 16 to 40 years; 8.03 kb for over 40 years. The telomere length of over 40 years was significantly shorter than that of less than 15 years (P=0.013), and than that of 16 to 40 years (P=0.011). The phase of telomere changes was evaluated by age subgroups. The shortening was fastest in individuals of age <5, while the length showed a plateau or slight increment in age group between 5 to 35. The length decreased steadily with age by the regression of 12.43+/-0.07 A (r= 0.500; P=0.034) in age group over 35. CONCLUSION: Telomere length of PBMCs decreases with age, and the different phase of telomere length shortening may suggest that the shortening of telomere is not a constant process over lifespan, but a dynamic process that is differently regulated in age groups.
Blotting, Southern ; Cell Division ; Chromosome Structures ; DNA ; Humans ; Infant, Newborn ; Tandem Repeat Sequences ; Telomere Shortening* ; Telomere*