ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To conduct a scoping review on the types, construction methods and predictive performance of health literacy prediction models based on machine learning methods, so as to provide the reference for the improvement and application of such models. Methods: Publications on health literacy prediction models conducted using machine learning methods were retrieved from CNKI, Wanfang Data, VIP, PubMed and Web of Science from inception to May 1, 2024. The quality of literature was assessed using the Prediction Model Risk of Bias ASsessment Tool. Basic characteristics, modeling methods, data sources, missing value handling, predictors and predictive performance were reviewed. Results: A total of 524 publications were retrieved, and 22 publications between 2007 and 2024 were finally enrolled. Totally 48 health literacy prediction models were involved, and 25 had a high risk of bias (52.08%), with major issues focusing on missing value handling, predictor selection and model evaluation methods. Modeling methods included regression models, tree-based machine learning methods, support vector machines and neural network models. Predictors primarily encompassed factors at four aspects: individual, interpersonal, organizational and society/policy aspects, with age, educational level, economic status, health status and internet use appearing frequently. Internal validation was conducted in 14 publications, and external validation was conducted in 4 publications. Forty-two models reported the areas under the receiver operating characteristic curve, which ranged from 0.52 to 0.983, indicating good discrimination. Conclusion Health literacy prediction models based on machine learning methods perform well, but have deficiencies in risk of bias, data processing and validation.

Objective To investigate the acceptance and satisfaction of tuberculosis prevention and control personnel in Beijing with the patient management system, and to provide a basis for further improving the patient management model. Methods A survey was conducted on the current usage, satisfaction, willingness to use and system improvement opinions of the patient management system among medical staff involved in the supervision and medication management of pulmonary tuberculosis patients in Beijing. Results A total of 360 medical staff participated in the survey. ^“Patient management^” was the function with the largest number of users, accounting for 96.94%. The proportion of users of each module who believed that the module's design met actual work needs was over 90%. About 94.44% of respondents believed that patient management systems facilitated the transfer and sharing of information between institutions. And 90.83% of respondents thought that the patient management system was easy to operate, and 89.17% of respondents believed that patient management systems reduced workload. About 97.50% of respondents were satisfied with the overall use of the patient management system. The results of the influencing factor analysis showed that those with 3 or less modules designed to meet actual work were less satisfied than those with more than 3 modules, and the difference was statistically significant (P=0.001). Respondents put forward suggestions for improvement on the optimization of operational details such as system response speed, interface design, system login and query statistics. Conclusion Medical staff involved in the follow-up management of pulmonary tuberculosis patients are highly satisfied with their work using the patient management system. During the promotion and use, it is still necessary to continuously optimize the system functions according to work needs so that the system can truly facilitate work.

Objective To investigate the epidemiological survey of pulmonary Aspergillus infection in a district of Hefei City, Anhui Province, from 2019 to 2023. Methods The data of 302 patients who attended and were treated in the respiratory department, thoracic surgery department, oncology department, tuberculosis department and RICU ward of Anhui Chest Hospital from January 2019 to September 2023 were selected, and patients with Aspergillus infections were taken as the observation group, patients with Candida infections were taken as the control group, and bacterial infections were taken as the blank group. The general information of patients, pre-treatment infection, underlying diseases, and use of antifungal drugs were analyzed. Compare the data of observation group and control group, and analyze the risk factors affecting pulmonary Aspergillus infection. Results Pulmonary Aspergillus infection 100 cases, accounting for 33.11%. Pulmonary Candida infection was 80 cases, accounting for 26.49%. The other 122 cases were other lung diseases, accounting for 40.40%. The most common causative agent of pulmonary Aspergillus infection was Aspergillus fumigatus (57.00%), cough, sputum and occasional blood were found in most of the patients (88.00%), most of the lesions were located in the right upper lobe of the lungs (55.00%), and most of the single or multiple cavities were seen on imaging (47.00%). Specimens mostly originated from the deep airways of hospitalized patients and there was a predominance of male patients. Risk factors for pulmonary Aspergillus infection were history of hospital transfer, ICU admission, mechanical ventilation, extracorporeal catheterization (intravenous catheter and urinary catheter), history of surgery within 15 days, history of diabetes mellitus, history of respiratory chronic disease, history of antifungal prophylaxis and abnormal serum indicators. History of hospital transfer (OR=2.951, P=0.008), history of diabetes mellitus (OR=5.073, P=0.018), history of chronic respiratory disease (OR=7.523 , P=0.028), extracorporeal catheterization (OR=3.142, P=0.022), and history of anti-fungal prophylaxis (OR=6.334, P<0.001) were Aspergillus pulmonaryis infection independent risk factors for infection. Conclusion Aspergillus fumigatus and Aspergillus flavus are the main pathogens of pulmonary Aspergillus infections in the region, and a history of nosocomial transfer, extracorporeal tubes, diabetes mellitus, chronic respiratory disease, and antifungal prophylaxis are independent risk factors for pulmonary Aspergillus infections.

The purpose of this paper is to explore the decoction and dosing methods of rhubarb root and rhizome in classical prescriptions and to provide a reference basis for the clinical use of rhubarb root and rhizome. By collating the relevant classical prescriptions of rhubarb root and rhizome in Shanghan Lun and Jingui Yaolüe, the relationship between its decoction and dosing methods and the syndrome was analyzed. The decoction of rhubarb root and rhizome in classical prescriptions can be divided into three categories: simultaneous decoction, decoction later, and other methods (impregnation in Mafei decoction, decoction with water from the well spring first taken in the morning, and pills). If it enters the blood level or wants to slow down, rhubarb root and rhizome should be decocted at the same time with other drugs. If it enters the qi level and wants to speed up, rhubarb root and rhizome should be decocted later. If it wants to upwardly move, rhubarb root and rhizome should be immersed in Mafei decoction. If it wants to suppress liver yang, rhubarb root and rhizome should be decocted with water from the well spring first taken in the morning. If the disease is prolonged, rhubarb root and rhizome should be taken in pill form. The dosing methods of rhubarb root and rhizome can be divided into five categories: draught, twice, three times, before meals, and unspecified. For acute and serious illnesses with excess of pathogenic qi and adequate vital qi, we choose draught. For gastrointestinal diseases, we choose to take the medicine twice. For achieving a moderate and long-lasting effect, we choose to take the medicine three times. If the disease is located in the lower part of the heart and abdomen, we choose to take it before meals. The use of rhubarb root and rhizome in clinical practice requires the selection of the appropriate decoction and dosing methods according to the location of the disease, the severity of the disease, the patient′s constitution, and the condition after taking the medicine.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

Electroencephalogram (EEG) is a non-invasive, high temporal-resolution technique for monitoring brain activity. However, affected by the volume conduction effect, EEG has a low spatial resolution and is difficult to locate brain neuronal activity precisely. The surface Laplacian (SL) technique obtains the Laplacian EEG (LEEG) by estimating the second-order spatial derivative of the scalp potential. LEEG can reflect the radial current activity under the scalp, with positive values indicating current flow from the brain to the scalp (“source”) and negative values indicating current flow from the scalp to the brain (“sink”). It attenuates signals from volume conduction, effectively improving the spatial resolution of EEG, and is expected to contribute to breakthroughs in neural engineering. This paper provides a systematic overview of the principles and development of SL technology. Currently, there are two implementation paths for SL technology: current source density algorithms (CSD) and concentric ring electrodes (CRE). CSD performs the Laplace transform of the EEG signals acquired by conventional disc electrodes to indirectly estimate the LEEG. It can be mainly classified into local methods, global methods, and realistic Laplacian methods. The global method is the most commonly used approach in CSD, which can achieve more accurate estimation compared with the local method, and it does not require additional imaging equipment compared with the realistic Laplacian method. CRE employs new concentric ring electrodes instead of the traditional disc electrodes, and measures the LEEG directly by differential acquisition of the multi-ring signals. Depending on the structure, it can be divided into bipolar CRE, quasi-bipolar CRE, tripolar CRE, and multi-pole CRE. The tripolar CRE is widely used due to its optimal detection performance. While ensuring the quality of signal acquisition, the complexity of its preamplifier is relatively acceptable. Here, this paper introduces the study of the SL technique in resting rhythms, visual-related potentials, movement-related potentials, and sensorimotor rhythms. These studies demonstrate that SL technology can improve signal quality and enhance signal characteristics, confirming its potential applications in neuroscientific research, disease diagnosis, visual pathway detection, and brain-computer interfaces. CSD is frequently utilized in applications such as neuroscientific research and disease detection, where high-precision estimation of LEEG is required. And CRE tends to be used in brain-computer interfaces, that have stringent requirements for real-time data processing. Finally, this paper summarizes the strengths and weaknesses of SL technology and envisages its future development. SL technology boasts advantages such as reference independence, high spatial resolution, high temporal resolution, enhanced source connectivity analysis, and noise suppression. However, it also has shortcomings that can be further improved. Theoretically, simulation experiments should be conducted to investigate the theoretical characteristics of SL technology. For CSD methods, the algorithm needs to be optimized to improve the precision of LEEG estimation, reduce dependence on the number of channels, and decrease computational complexity and time consumption. For CRE methods, the electrodes need to be designed with appropriate structures and sizes, and the low-noise, high common-mode rejection ratio preamplifier should be developed. We hope that this paper can promote the in-depth research and wide application of SL technology.

ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe₃O₄ nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

Bone marrow suppression is one of the common adverse reactions to radiotherapy and chemotherapy. Anticancer treatments such as radiotherapy and chemotherapy first directly damage the patient′s peripheral blood cells, impairing qi and blood; further, they damage the actively proliferating cell populations in the bone marrow, impairing yin and blood; and then they interfere with hematopoietic stem cells, impairing essence and blood. This process is rapid and intense, consistent with the characteristics of " acute deficiency syndrome" , marked by sudden onset, rapid changes, critical condition, complexity and variability, multiple complications, and poor prognosis. Given this, its diagnosis and treatment should differ from those of general deficiency syndromes. This paper advocates the principles and ideas of diagnosis and treatment such as " preventing first and treating early to prevent changes; supplementing for deficiency and strengthening vital qi to eliminate pathogenic factor; urgent rescue for critical conditions, no time to lose; and comprehensive supplementing throughout the process, with severe cases requiring singular action" . This approach is intended to provide theoretical reference and practical guidance for bone marrow suppression after radiotherapy and chemotherapy.