ObjectiveTo analyze the trend of lung cancer incidence in Fenghua District, Ningbo City of Zhejiang Province from 2009 to 2023, and to estimate the age-period- cohort effects of incidence rate, so as to provide scientific basis for the formulation of lung cancer prevention and control measures in Fenghua District. MethodsJoinpoint software was utilized to analyze the trends and calculate the average annual percentage change (AAPC) of lung cancer incidence based on the tumor incidence surveillance data from Fenghua District, 2009‒2023. The age-period-cohort (APC) model for lung cancer incidence was analyzed using STATA 17.0 software, and net drift and local drift of lung cancer incidence rates were analyzed using online analytical tools. ResultsThe incidence of lung cancer in Fenghua District showed an overall upward trend from 2009 to 2023, with the standardized incidence rate increasing from 45.05/100 000 in 2009 to 108.20/100 000 in 2023(AAPC=7.05%, P<0.05). The increase in the standardized incidence rate for females (AAPC=12.72%, P<0.05) was higher than that for males (AAPC=2.97%, P<0.05). The overall net drift in lung cancer incidence for residents of Fenghua District was 11.71%, with the net drift for females (16.54%) being higher than that for males (6.64%). The local drift in lung cancer incidence among different age groups ranged from -3.37% to 35.18%. The results of APC model showed that the risk of lung cancer incidence increased and then decreased with age, with the highest age effect coefficient observed in the 65‒69 years age group at 1.08. The period effect showed a gradually increasing trend in lung cancer incidence risk with the progression of time, and the period effect coefficient in 2019‒2023 (0.46) was higher than that in 2009‒2013 (-0.39), increasing by 217.95%. The cohort effect coefficient showed a trend of first decreasing and then increasing with the expansion of the birth cohort, in which the lowest cohort effect coefficient was -1.07 observed in the birth cohort of 1964‒1968 and the highest cohort effect coefficient was 1.77 in the birth cohort of 1924‒1928. ConclusionThe incidence of lung cancer in Fenghua District shows an upward trend from 2009 to 2023, with a higher increase in incidence rates among females than that in males. The risk of lung cancer incidence exists a trend of increasing and then decreasing with age growth. With the progression of time, the risk of lung cancer incidence shows a gradually increasing trend. However, with the expansion the birth cohort, the risk of lung cancer incidence demonstrates a trend of first decreasing and then increasing.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

Male factors contribute to 50% of infertility cases, with 20%-30% of cases being solely attributed to male infertility. Helicase for meiosis 1 ( HFM1 ) plays a crucial role in ensuring proper crossover formation and synapsis of homologous chromosomes during meiosis, an essential process in gametogenesis. HFM1 gene mutations are associated with male infertility, particularly in cases of non-obstructive azoospermia and severe oligozoospermia. However, the effects of intracytoplasmic sperm injection (ICSI) in HFM1 -related infertility cases remain inadequately explored. This study identified novel biallelic HFM1 variants through whole-exome sequencing (WES) in a Chinese patient with severe oligozoospermia, which was confirmed by Sanger sequencing. The pathogenicity of these variants was assessed using real-time quantitative polymerase chain reaction (RT-qPCR) and immunoblotting, which revealed a significant reduction in HFM1 mRNA and protein levels in spermatozoa compared to those in a healthy control. Transmission electron microscopy revealed morphological abnormalities in sperm cells, including defects in the head and flagellum. Despite these abnormalities, ICSI treatment resulted in a favorable fertility outcome for the patient, indicating that assisted reproductive techniques (ART) can be effective in managing HFM1 -related male infertility. These findings offer valuable insights into the management of such cases.
Humans ; Male ; Sperm Injections, Intracytoplasmic ; Oligospermia/therapy* ; Adult ; Spermatozoa/ultrastructure* ; Exome Sequencing ; Mutation

Triclocarban (TCC) is a broad-spectrum antimicrobial widely used in various personal care products, textiles, and children's toys. TCC has potential reproductive and developmental toxicity in animals. However, little is known regarding the effect of TCC on human sperm function. In this study, an in vitro assay was used to investigate the effects of TCC on normal human spermatozoa and the possible underlying mechanisms involved. Semen from healthy male donors was collected and cultured in complete Biggers, Whitten and Whittingham (BWW) and low-sugar BWW media, followed by treatment with TCC at concentrations of 0, 0.1 µmol l -1 , 1 µmol l -1 , 10 µmol l -1 , and 100 µmol l -1 for 4 h. TCC was found to reduce the sperm total motility and progressive motility. Moreover, the sperm kinematic parameters, straight-line velocity (VSL), average path velocity (VAP), and curvilinear velocity (VCL) were affected in a dose-dependent manner. After treatment with TCC at the lowest effective concentration of 10 µmol l -1 , TCC caused a significant decrease in mitochondrial adenosine triphosphate (ATP) production and mitochondrial membrane potential (MMP) and a significant increase in reactive oxygen species (ROS), similar to the observations with the positive control carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), suggesting that TCC may decrease sperm motility by affecting the oxidative phosphorylation (OXPHOS) pathway. In a sugar-free and low-sugar BWW culture environment, TCC enhanced the damaging effect on sperm motility and ATP, MMP, and lactate decreased significantly, suggesting that TCC may also affect the glycolytic pathway that supplies energy to spermatozoa. This study demonstrates a possible mechanism of TCC toxicity in spermatozoa involving both the OXPHOS and glycolysis pathways.
Male ; Sperm Motility/drug effects* ; Humans ; Carbanilides/pharmacology* ; Oxidative Phosphorylation/drug effects* ; Glycolysis/drug effects* ; Membrane Potential, Mitochondrial/drug effects* ; Adenosine Triphosphate/metabolism* ; Spermatozoa/metabolism* ; Reactive Oxygen Species/metabolism* ; Mitochondria/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

OBJECTIVES: To study the clinical characteristics of pediatric Behçet syndrome (BS). METHODS: A retrospective review was conducted on the medical records of children hospitalized in the Department of Pediatrics at the Second Hospital of Hebei Medical University between December 2014 and December 2024 who met diagnostic criteria for BS. RESULTS: Among 45 children with BS, 26 (58%) were male. Oral aphthous ulcers were the most common manifestation (43/45, 96%), followed by genital ulcers (23/45, 51%) and gastrointestinal involvement (18/45, 40%). Genital ulcers were more frequent in girls, whereas ocular involvement was more common in boys (P<0.05). The pathergy test was positive in 10 (22%), and HLA-B51 was positive in 13 (29%). Fecal calprotectin (FC) was elevated in 16 (36%); gastrointestinal involvement was more frequent in children with elevated FC than in those with normal FC (P<0.05). According to the respective criteria, 17 (38%) patients met the International Study Group criteria (1990), 33 (73%) met the International Criteria for Behçet Disease (2014), and 13 (29%) met the Pediatric Behçet Disease criteria (2015). CONCLUSIONS Pediatric BS shows marked clinical heterogeneity. HLA-B51 is associated with disease susceptibility.
Humans ; Behcet Syndrome/genetics* ; Male ; Female ; Child ; Retrospective Studies ; Adolescent ; Child, Preschool ; Leukocyte L1 Antigen Complex/analysis* ; HLA-B51 Antigen

Malignant tumors are one of the major diseases that endanger human life and health. Chinese medicine has unique advantages in clinical anti-tumor treatment. However， how to translate the anti-tumor effects of Chinese medicine into clinical practice is the core issue that must be addressed in the process of treating malignant tumors with traditional Chinese medicine （TCM）. Unlike modern chemical drugs， the compatibility application of Chinese medicine is the key factor that determines whether Chinese medicine can achieve optimal anti-tumor efficacy and realize the goal of "enhancing efficacy and reducing toxicity". The formulation structure based on this compatibility is the basic form for the safe， efficient， and rational clinical use of anti-tumor Chinese medicine， and it mainly includes three categories： herb pairs， tri-herbal combinations， and compound compatibility. Although herb pairs have the characteristics of a simple structure and strong targeting （enhancing efficacy and reducing toxicity）， they often have a single effect and cannot fully address the complex pathogenesis of tumors. As a result， herb pairs are rarely used alone in practice. Compared to herb pairs， tri-herbal combinations broaden the application scope of herbs in clinical treatment， but their therapeutic range remains limited. The traditional "sovereign， minister， assistant， and guide" compound prescription， which includes herb pairs and tri-herbal combinations， improves the efficacy of herbs in treating serious diseases， hypochondriasis， chronic diseases， and miscellaneous disorders. However， due to the limitations of its historical background， it has not been integrated with modern clinical practice and modern pharmacological research， which restricts the development of compound compatibility theory. With the emergence of modern medical technology， it has been combined with traditional compatibility theory of Chinese medicine to create an innovative modern compatibility theory. This includes the "aid medicine" theory derived from modern Chinese medicine pharmacology， which compensates for the inability of the "sovereign， minister， assistant， and guide" theory to accurately apply medicine. Additionally， the "state-targeted treatment based on syndrome differentiation" theory， developed from pharmacology and modern medicine， addresses the deficiency in disease cognition in the "sovereign， minister， assistant， and guide" theory. Under the guidance of these compatibility forms and theories， clinical anti-tumor Chinese medicine can exert its maximum anti-tumor efficacy， which is of great significance for the application of Chinese medicine in clinical tumor treatment.

Nine compounds were isolated and purified from 90% ethanol extract of Alstonia mairei Lévl by using various chromatographic methods, including silica gel, SephadexLH-20, MCI Gel and ODS column chromatography, combined with semi-preparative liquid phase separation methods. Modern spectroscopic methods (1D and 2D NMR, UV, IR, MS, etc.) were used to identify the structures of the isolated compounds. They were identified as mairoside A (1), 3′,6-di-O-sinaloylsucrose (2), myristic acid (3), methyl myristate (4), ethyl myristate (5), 3,4,5-trimethoxycinnamic acid (6), 3,4,5-trimethoxybenzoic acid (7), vinoline (8), kaempferol-3-O-rutinoside (9), among which compound 1 is a new glycoside, compounds 4 and 5 are new natural products, and the nuclear magnetic data of compound 4 were reported for the first time.

Eight compounds were isolated and purified from the ethyl acetate part of 70% acetone extract of Rehmannia glutinosa by various chromatographic techniques such as silica gel, MCI gel CHP-20, ODS, Toyopearl HW-40C, combined with TLC and semi-preparative HPLC. Their structures were elucidated by modern spectroscopy techniques (NMR, MS, UV, IR), and identified as neomartynoside A (1), osmanthuside B₆ (2), martynoside (3), isomartynoside (4), (E)-p-hydroxycinnamic acid (5), caffeic acid (6), ferulic acid (7), and methyl caffeate (8). Compound 1 is a new phenylethanol glycoside, which was identified as neomartynoside A. Compound 2 was isolated from Rehmannia glutinosa for the first time. In addition, compounds 2, 6 and 7 significantly increased relative glucose consumption, showing potential hypoglycemic activity.